• Darwin’s Doubt – Prologue Part III

    I was going to give a pass to the discussion of information (specified or otherwise) in the hopes that Meyer will more fully discuss this later on in the book.  I have little hope for this though.  So…  The terms and such that are used by ID proponents are extremely wishy-washy and, to date, no one has ever calculated (or even shown how to calculate) the information (specified or otherwise) in any living thing, protein, or DNA sequence.

    You see, the problem for ID is simple.  Calculating the information content of a string of text is really trivial.  And DNA and proteins can be broken down into a string of text (4 nucleotides or 20 amino acids).  The problem is that this doesn’t tell us anything.  Information content doesn’t talk about the function.  For example

    ACCGATCGTACGTACGTAGCTAGCTAGTCGATCGTACGTGCATGCTA

    and

    ACCGATCGTACGTACGTAGCTAGCTAGTCGAACGTACGTGCATGCTA

    have exactly the same amount of information.  The only difference is the bolded nucleotide in the lower one.  The problem is that the information content doesn’t tell us whether that bolded nucleotide makes a difference to the resulting protein (or whatever that DNA sequence does).

    So we have to get into the FUNCTION of the DNA sequence and that’s something that no one has been able to quantify yet.  Does that single change make the protein (or control sequence) non-functional?  Does it make it better?  Does it do nothing?  Does it make the system do something else entirely?

    And once you find out what that change does, how do you quantify it?

    That’s what ID lacks.  Everyone knows that, in terms of straight information, those two sequences are the same.  But the ID proponents can’t calculate or determine “specified” or “functional” and that’s their big problem.

    How can Meyer say

    No undirected physical or chemical process has demonstrated the capacity to produce specified information starting “from purely physical or chemical” precursors

    When he has no idea what “specified information” is in the first place.

    I’ll point out here that physical and chemical processes covers the entirety of the universe.  So, according to Meyer, the only thing that can create this specified information is beyond the natural universe… that is, the supernatural.

    Meyer goes on to talk about how in Signature in the Cell, he says that something can create this specified information… intelligence.  Of course, he has never done any research on this.  He assumes this.  And that’s a major problem with ID.  They assume what they are trying to prove.

    Until they actually define specified information and start to calculate it and give the requirements for non-intelligence produced information and intelligent produced information, then the discussion of information is a waste of time.

    Meyer gives us a list of the things that have “functional information” a new word that he doesn’t define.  That list is: “embedded in a radio signal, carved in a stone monument, etched on a magnetic disk, produced by a scientist.”

    Anyone want to guess the difference between those things and life?  Something that Meyer and the others don’t talk about.  Something called inexact reproduction…

    Meyer might have heard about this concept in his high school biology class.  It’s pretty simple.  Organisms can reproduce.  Radio signals, sculptures, computer programs can’t.  Well, actually computer programs can… sort of.  But what’s fascinating is that this entire field of reproducible software is called evolutionary programming and is one of the richest and most valuable fields of computer science.  Evolutionary algorithms have produced results that intelligence HAS NOT BEEN ABLE TO.

    And that’s a devastating response to intelligent design.  Very simply, using evolutionary principles has resulted in systems that intelligence can’t even explain, much less reproduce.

    One last note.  Meyer makes a fundamental mistake when discussing the origins of life.  He assumes that early life on Earth must be exactly like life is now.  With DNA and RNA and ATP and enzymes and ribozomes and all that kind of thing.  He says, and rightly so, that there’s no way to go from base compounds to modern living systems.  He’s right.

    It’s a good thing that is not how scientists think it happened.  I provided some evidence in the previous installment.  Origins of life is a huge field of research, hundreds of papers are published in the field annually.  And so far, not a single one has said “this result makes it impossible”.  Indeed, there are often multiple pathways to get to certain chemicals. And once you have certain chemicals, then they will combine, even if randomly and we’ve seen that even very, very short ribozymes can act as catalysts.

    Is that a just so story… kind of, but it’s backed up by 60 years of research data.  It could happen.

    ID doesn’t even have that yet.

    The rest of the series.

    Category: Book Review

    Article by: Smilodon's Retreat

    • Dkennedy

      “But what’s fascinating is that this entire field of reproducible software is called evolutionary programming and is one of the richest and most valuable fields of computer science. Evolutionary algorithms have produced results that intelligence HAS NOT BEEN ABLE TO.”

      Interesting. So you have computer programs that people didn’t write? That’s amazing!

      Oh wait, they DID write them — whatever they may have been taking their inspiration from, these ‘evolutionary algorithms’ are programs – written by intelligent people, doing what THEY think is mimicking evolution.. although such a concept is a farce.

      These are pieces of software that “attempts to model macroevolutionary dynamics”

      Is a model of the universe the universe? Can you write a math equation that describes it?

      Geesh.

      ..and you think meyer has vague definitions like “specified complexity”, while thinking people writing software based on someone’s IDEA of evolutionary processes is somehow exact? Amazing.

      • SmilodonsRetreat

        Programs and experiments are designed. But the RESULTS of those programs and experiments are not.

        This is not new stuff. You’re saying the same crap that has been refuted dozens of times this lat year alone.

        Yes, I think Meyer hasn’t a clue what specified complexity is. Why don’t you prove me wrong. Give the page number in his book where he defines it and calculates it for ANYTHING.

        • Dkennedy

          So you have a program that is disconnected from the produced results!? Wonders never cease with you.

          I honestly can’t believe you actually just said that.

          The progams are designed “but the results are not”… — wow.

          Here’s a program for you
          10 Print “A”
          20 go to 10

          AAAAAAAAAAA

          How can you say the program is designed but the results are not? Do you hear yourself?

          • SmilodonsRetreat

            You obviously have no idea how evolutionary algorithms work. I would encourage you to read up on them.

            I can point you to at least a dozen examples (from decades ago) of evolutionary algorithms that produced results faster and significantly more effective than teams of humans engineers could produce. I know of one case in which an evolved system still cannot be explained by human engineers, yet it does the evolved function and does so using less nodes than the best human design ever created for that function.

            SO, yes, I do hear myself. I know exactly what I am saying and you are looking like an idiot for not understanding the basics of the systems you are trying to argue against.

            I will note that this is another argument that I’ve had dozens of times in the last year. You aren’t the first. You aren’t even the hundredth person to have these discussions with me.

            And those hundreds of people may not ever have changed their mind. But I’m willing to, if you provide evidence. So, step up. Who is the designer. What did it do? When? How? And how do you know?

            • Dkennedy

              ” I would encourage you to read up on them.”:

              I have. There are formulas inspired by the patterns of so called evolution.

              You can model it after pretty much anything and it’s the same idea, you are modeling the activities of nature and seeing that things ‘work better’ when you simulate what nature does. Big surprise.

              And geckos climb walls and we are inspired to make gloves for the military because of them. YES, nature does everything better than we do — but you, of course, are looking at it backwards. You see it as somehow ‘nature just does that, it’s really smart – and we should learn from it’s (ignorant) brilliance! The whole time you have missed the point that we know to do things like this personally and they are characterized by intelligence….

              But see.. nevermind – it’s back to the same idea, you just think “nature just does that”.

            • SmilodonsRetreat

              You must not have if you make such simplistic errors when talking about them.

              Of course we model evolution. That’s what an evolutionary algorithm is. And the evidence is quite clear. It is extremely effective. In everything from optic design to factory schedule planning.

              Of course nature “does it”, there is nothing but “nature”.

              Look, I’ve seen this time and time again. You attack evolution because you think that it will somehow make ID or god or design work. It won’t. You could disprove evolution right here, right now (you won’t, but you could theoretically). It still won’t mean there is a designer. Only positive supporting evidence of a DESIGNER will do that.

              The existence of design won’t do that. If you fail to consider the “intelligence” (which all intelligent design advocates do), then the ‘design” is all that is left. And evolution is a perfectly capable designer. It works in computers. It works in the lab. It has worked for a million times longer than any intelligence has been in existence on this world.

              You want to show that everything on Earth was designed, then you have to answer those questions. Who is the designer, when does it work, using what tools, and how do you know?

            • Dkennedy

              And no, I disagree.

              I’m an independent single person – I can “speculate” on what that designer is, but it is an entirely separate issue.

              Of course those who notice that it isn’t logical to think a random process manifested all we see before us tend to be believers — it’s the other conclusion. It’s entirely irrational to think that a rational process is created by a irrational force – it’s as simple as that really.

              Like makes like — tree > tree, life > life — it’s been something noticed going back to Aristotle and actually far before. Patterned, well CONCEIVED ideas — CONCEPTS come from mind. We know that. All of our words are modeled around this understanding. Makers make. Creators create. Laws are written. I would have to think you live in a world where anything can happen, because you feel ‘nature’ can do things vastly superior to what our minds can — that brings an obvious realization.

              Even in the idea that the world came to be ‘for no reason’, we have the root of ‘reaaoning’… a mind. Nothing happens for no reason – never has – never will.

            • SmilodonsRetreat

              You may now stop misrepresenting evolution. You’ve been told this by me at least once. Continuing to misrepresent it is lying… and I believe your god has something to say about that.

              Mutation is random. Selection is not.

              Abiogenesis is not evolution. It’s chemistry and the evidence is massive that life can develop from non-life under certain conditions. I can drop well over 200 papers on you right now that support the idea that life can develop from non-life.

              Now, who is the designer, how did it do it, when, and how do you know?

            • Dkennedy

              Awesome! So they can make life out of non living material! So let’s get to work making some life.. I’m sure they must be able to whip up a batch in the lab .. right? I mean, if you have 200 papers that show it’s so –

              Or….. is it just one of those cases where science has decided that if it tells a story it’s just as good as actually using the scientific method and repeatable tests? Cause they have become so spoiled with the tendency of the public accepting a story about “why developing cooked food was essential to evolution” and all of these 1000’s of stories where they can simply state ‘this could have happened’ – but state it as a fact, that they don’t seem to actually need to do the rigor of real science.

              But, I mean hey, they can create life out of non living material! Pretty cool. Strange that I haven’t seen the articles all over showing they have done it.

            • SmilodonsRetreat

              The point is that there is no physical or chemical reason to reject abiogenesis.

              There is a reason to reject intelligent design.

              Tell you what. You provide an equivalent amount of evidence for the designer.

              I find it interesting that you constantly refuse to discuss this evidence. You demand massive amounts of evidence from science. Evidence that any scientist will tell you is unreasonable. Yet you utterly refuse to provide the same level of detail for your own notions. Bias. Look it up.

            • Dkennedy

              You know.. I’m at work, and don’t really have the ability now to adequately put down everything I’d like to say — I want to, but really don’t have the time – but I’ll do the short version:

              Did weather evolve?

              Of course not… right? But it does ‘change’ over time. So let’s imagine biological systems being formed in a given environment. Isn’t it interesting that here we have weather systems that conspicuously seem to ‘care take’ for the earth. They wash the earth from pole to pole, they recycle the used water, the winds carry nutrients from living areas to barren areas – the lightning strikes dead wood, catches it ablaze and it then brings forth new life. You can actually watch these storms begin at the antarctic, they then go over the ocean and you can see plankton bloom in huge masses miles and miles wide that then feeds the fishes. Etc.

              Now, if our biological system built AROUND this weather that is changing – we would have no reason to expect that this system would work. “But life ADAPTS” you say? But there isn’t even a reason to expect this weather would form in any ‘care taking’ fashion. As a random occurrence it could form in a way that wasn’t beneficial to the system as a whole — there would (more likely than not) be a system that simply would not function (astronomically more likely than not). And even if the system did function, there is astronomically no likelihood that that useful functional pattern would continue.

              You say ‘nature just does that’ – I say that is not a logical or scientific view to have.

              You can’t see a system for what it is from inside the system. You can’t understand a computer from within the computer – you need to be outside it to see it for what it is.

              One fish swims over to the other fish — and he says “Well, if there is no God, then who changes the water?”

            • SmilodonsRetreat

              That’s the worst analogy I’ve ever heard. Here’s the thing about analogies, they are great for teaching and useless for actual arguments.

              Weather does not evolve. Weather does not pass genetic information to the next generation. Weather does not undergo mutation and selection.

              Life adapts… to CLIMATE not weather. You don’t even know the basic difference in definitions. Weather, as you describe, is the daily patter of atmospheric conditions in a local area. Climate is a multi-year, multi-thousand year system that influences how the weather will be (more or less rain, more or less temperature, etc)… not daily, but over thousands of years.

              Populations can (usually) adapt to that level of change in climate. They cannot adapt to extremely rapid weather events.

              I don’t say “nature just does that”. I say that there is a constant set of principles by which nature does those things. Differential heating causes wind. evaporation results in clouds, change in temperature (usually due to altitude) results in precipitation. These are well understood principles that allow us to PREDICT the weather. Just like evolutionary principles allow us to predict changes in life.. and the past history of life.

              OK, fine. Provide evidence that your god exists. If you think God is designer… which god? What is the evidence for that god?

            • Dkennedy

              So let’s look at your reply

              :”Weather does not evolve”

              I know. That was the point.

              I used it as an example because no one can state it did evolve, because it doesn’t – that way no one can state that the weather is somehow adapting in some sort of quasi- Lamarckian fashion.

              And then you go on a bender about the fact that I said weather rather than climate… because “Weather, as you describe, is the daily patter of atmospheric conditions in a local area. Climate is a multi-year, multi-thousand year system”

              Yes, weather would be day to day or month to month short term changes, yet the definition of weather is:

              “the state of the atmosphere at a place and time as regards heat, dryness, sunshine, wind, rain, etc”

              Climate portrays long periods of time Weather portrays a state. I should have switched from weather to climate depending on the time frame – although big deal. Weather changes — climate is a long term trend.

            • SmilodonsRetreat

              OK, good. we’re to that point.

              However, I notice what you didn’t comment on.

              “Weather does not pass genetic information to the next generation. Weather does not undergo mutation and selection.”

              So, you started an entire discussion that was moot when you started and refused to comment on the point that I made about evolution.

              Shocking.

            • Dkennedy

              Right, I didn’t address it, cause commenting and reading this review is something I do while I have free time at work. It was time to go home.

              I read back through the comment and I don’t see a new point made.

              I’m speaking of the apparent care-taking aspects of the weather. I’m speaking of the fact that it waters and feeds the world through those processes. As far as not addressing the fact, you didn’t. I would anticipate the rather predictable responses that ‘it just appears that way’ or that ‘animals evolved in that CLIMATE to benefit from it’, but my point was that CLIMATES change, and drastically so. No situation that was workable in this exact manner would likely continue over millions of years. At one point there wouldn’t have even been co2 in the atmosphere — so we are talking massive change. And as I stated, they could very well be adapting for failure, because organs developing to take advantage of a chemical make up at one stage of the climate’s history would not be useful later on. It’s ridiculous to even assume that there would be an environment that COULD always be taken advantage of.

              It’s the conspicuous nature of the whole thing. From the washing of the land – the burning down of dead material to create new life. The environment is on autopilot and takes care of itself. This is the part that you glossed over. Explaining how air pressure works is entirely irrelevant to the question and does nothing to address it.

              Provide evidence that God exists? It’s all around you — you just have decided to say it’s some brilliance of ‘nature’. The entire system works as one whole – the bees pollinate the plants, without one or the other the food chain breaks down. There’s pretty much nothing in it that isn’t interdependent — we have a sun that provides light and heat, a moon as a night light (actually, without the moon, from what I hear, there’d be no life). You have replaced all the evidence of God with a dumb nature, that as you have stated, is more brilliant than teams of engineers, yet you don’t find that as any indication that this ‘nature’ is designed.

              What God? There’s only one. It doesn’t matter what you name that God. Remember me stating that you can’t fully understand a system from inside the system? If you were in that computer and you knew something outside of it constructed it and wrote the programs – there’s a good chance that different people would call it different things – and the details they come up with would very likely be incorrect, but that’s expected and forgivable, because this information isn’t available to them. I know you’re just leaning towards the cliche Richard Dawkins ‘which God’ line, because it seems people find that to be so clever… it’s not, and neither is the “well, who made God” line – neither are relevant to the question at hand.

            • SmilodonsRetreat

              Again, because you apparently didn’t read it the first time. Weather is a well understood phenomenon that has a basis in basic physics and chemistry. Just like life. A basis in physics and chemistry.

              Where did chemistry come from? That we don’t know. But if you assume a designer, then you have to provide evidence for the designer. I don’t care if you call it god, Thor, Cthulhu, the Matrix, aliens, or time-travelling cell biologists… you still have to provide evidence for that intelligence. Since you can’t (and we both know it), then the only reasonable solution is the one that actually does work, makes predictions, and follows the known rules of the entire universe… that is physics, chemistry, and biology. Thus evolution.

              Anything else is just wishful thinking. I really hope you read these reviews and see how much Meyer is lying to you. I hope you take that to heart.