Pages Menu
TwitterRssFacebook
Categories Menu

Posted by on Feb 15, 2013 in Creationism, Evolution, Science and religion | 94 comments

Endogenous Retroviruses as evidence for evolution

Here is a concise synopsis from Smilodon’s Retreat, here at SIN. I am fascinated with endogenous retroviruses (ERVs). It seems that they are simply not adequately explained on a creationism thesis. This usually entails trying to debunk them since they have no other answer!

Viruses are amazing things.  I don’t think anyone would argue that they are actually living things.  But they are extraordinarily complex systems and can have massive effects on organisms that as large to them as the a town is to us.  Here’s a neat little animation that shows the scale of some viruses.

One particular class of virus is particularly interesting.  We all should know about how most viruses work.  They invade the cell, co-opt the organelles and make the cell do nothing but build new viruses.  After some time, the cell dies, releasing all those new viruses into the host organism. The retroviruses are different.

I hesitate to use the word ‘insidious’, because they aren’t.  They are just doing what they do.  But to us, it seems insidious.  Instead of just invading the cell and co-opting the organelles, a retrovirus actually inserts DNA into the genome of the cell.

A retrovirus is actually a RNA virus.  The virus’s genetic material is stored as messenger RNA.  The RNA is reverse transcribed into DNA in the host cell.  Transcription is the process of forming an mRNA strand from DNA.  Since the virus does the reverse, it’s a “retrovirus”.  Retroviruses even have to bring a unique tool with them.  The pol gene is responsible for making the viral reverse transcriptase, since cellular enzymes can’t perform that function.

So we have this unique mechanism in the retrovirus.  But it gets more interesting.  The viral DNA gets inserted into the host organism DNA.  The cell then uses the viral DNA as a template for viral proteins.  Instead of being co-opted, producing new viruses, and then dying, the cell lives it’s full life making new viral bodies along with everything else it’s supposed to do.

If the virus attacks a gamete, then that viral genome can appear in every cell in the offspring’s body and be passed on to future generations.  It sounds like a great deal for the virus.  However, the viruses are very sensitive.  Viral genomes are often very tight, very compact, and very susceptible to mutation.  Humans and other plants and animals (and other species as well) have multiple copies of each gene.  So, if one of those alleles is broken by mutation, there is a spare.  Viruses and bacteria don’t have this feature.

A mutation that damages the virus’s ability to perform any of the functions it must perform (invade a host cell, reverse transcribe the RNA, build the protein coat, etc) means that the virus is no longer effective.  The entire genome is broken, the virus can no longer function, but the DNA is still there, in the host organism.

That is called an endogenous retrovirus (ERV).

How can this be evidence for evolution?  Good question, I’m glad you asked.

Let’s say an organism gets one of these ERVs in its gametes and passes that gene onto it’s offspring.  Except the offspring ends up with a mutation that breaks the viral gene (crossing over for example).  Now, that organism has a gene that doesn’t affect anything, but it’s there.*

All of that organisms offspring will have a copy of that gene and, more telling, that gene will be in the same relative place.  As time goes on and the species diverges, speciation events occur and mutations happen, a pattern will emerge.  That pattern is the same as what is predicted for the idea of common descent.  That is, organisms will share a common ancestor and those organisms that are more closely related will have a more recent common ancestor.

2000 study of primates shows this very well.  All monkeys contain two particular ERVs.  Another two ERVs are shared by all monkeys except new world monkeys.  Three more are shared only by gibbons, orangutans.  Another two are only shared between chimps, gorillas, and humans.  And three more appear only in humans.  This is but a tiny bit of the 30,000+ ERVs in our genome. A similar situation appears in felids.

If common descent were not correct, then we would not expect to see dozens of species with the exact same viral remnant in the exact same genomic position. For example, it would be highly unlike to find a cat with the same two ERVs shared by humans, chimps and gorillas.

If common descent were not correct, then we would not see a relationship between shared ERVs and the closeness of two species.  The more closely related the organisms, the more ERVs they share.

_______
* There is significant evidence that ERV remnants do affect expression of other genes and that organisms can co-opt the former viral genes as well.  But go with me here.

  • frisbee_kid

    The claim is a virus infects an organism and gets into its gametes. The gamete is not dameged enough to make it non-viable and it is able to reproduce. The offspring that gets the ERV can then pass it on to its offspring and then it can spread an become fixed in the population- meaning all organisms in that population would have it. Never mind all of the luck that goes into having something that is not an advantage becoming fixed- meaning it ain’t science.

    But anyway, what we find today are NOT complete and intact ERVs. We find remnants of what we think were ERVs, ie they “look like” ERVs. IOW we don’t know if what appears to be parts of an ERV were actually even ever part of an ERV.

    Also, it appears that ERVs have preferred integration sites, which means similar organisms can be infected at a similar locus without any common ancestry connection.

    So it remains that until evos can actually come up with some evidence that supports the transformations required, universal common ancestry is untestable and not science.

    See also:

    ERVs, no help to evolutionism- (my bet is people will attack the website and not the evidence)

  • frisbee_kid

    Here’s more:

    Large scale function for ‘endogenous retroviruses’- Those elements that “look like” ERVs actually aid transcription in over 1/5 of our genome

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    Also, it appears that ERVs have preferred integration sites, which means similar organisms can be infected at a similar locus without any common ancestry connection.

    I want you to provide me with the probability for this, if that is your thesis.

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    “universal common ancestry is untestable and not science”

    Er…

    In the same way you test effects of the Big Bang to hypothesise about the Big Bang, so to with common descent. It is science. You are wrong.

  • frisbee_kid
  • frisbee_kid

    That’s it? Yet you cannot measure it nor quantify it (universal common ancestry). You don’t know how many mutations it takes to get a new body part nor a new body plan.

    Can you even produce a testable hypothesis that is exclusive to common ancestry? How about tat hypothsis based on  the ToE’s mechanism of accumulations of genetic accidents?

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    You can’t just link attack like that. I do not have the time to read all that. Please summarise some of the main points for discussion.
    Thanks.

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    Do you know how much positive evidence you have to discount and THEN find explanations for, for common descent? I don’t think you have a clue! Even Behe accepts it!

    You can measure evolution in species now. We can empirically see it. Italian wall lizards, in 35 years, evolved a larger average size, shorter hind limbs, lower maximal sprint speed and altered response to simulated predatory attacks compared to the the original population.

    Take the guppy work that creationists use to try to discount evolution! Dude, you are fighting a losing battle. Common descent is so overwhelmingly well-evidenced that I am amazed you spend your time trying to massage your own religious beliefs into disbelieving it!

  • Andy_Schueler

    The claim is a virus infects an organism and gets into its gametes. The gamete is not dameged enough to make it non-viable and it is able to reproduce.

    Which does indeed happen

    The offspring that gets the ERV can then pass it on to its offspring and then it can spread an become fixed in the population- meaning all organisms in that population would have it. Never mind all of the luck that goes into having something that is not an advantage becoming fixed- meaning it ain’t science.

    The fixation probability can be precisely calculated and is a consequence of the selection coefficient, recombination rates and effective population size. In species with very low effective population sizes (which includes all mammals), neutral and even slightly deleterious mutations can, and are, fixated in the population. And population genetics is indeed science, the opinion of scientifically illiterate creationists notwithstanding.

    But anyway, what we find today are NOT complete and intact ERVs. We find remnants of what we think were ERVs, ie they “look like” ERVs. IOW we don’t know if what appears to be parts of an ERV were actually even ever part of an ERV.

    This is kind of like arguing that a corpse, which was identified to be Mr. Smith by DNA profiling, fingerprints and dental records, might not actually be Mr. Smith because “we found only remnants that look like Mr. Smith”. 
    We actually know very well which parts belonged to retroviruses, we can even reconstruct what they looked like and reconstruct an infectious retrovirus from the remnants that are still observable in our genomes.

    Also, it appears that ERVs have preferred integration sites, which means similar organisms can be infected at a similar locus without any common ancestry connection.

    If you were able to read and understand the paper you quoted in a later comment ( http://www.sciencedirect.com/science/article/pii/S0092867403007608 ), you would see that this does not refer to a specific site, but rather to a specific genomic context (see table 1 in the paper you linked to). Some ERVs prefer promoter regions, some prefer active genes, some are indiscriminate, some are highly selective for Pol III genes etc. The location where the virus integrates is biased towards a specific genomic context, but the precise location is still random. Also, there is phylogenetic signal in a) the integration profile, b) the sequence of the provirus and c) the sequence of the flanking LTRs. Which makes ERVs overall very reliable phylogenetic markers. 

    So it remains that until evos can actually come up with some evidence that supports the transformations required, universal common ancestry is untestable and not science.

    The first part of this sentence is semantic nonsense and the second part is simply wrong.  Universal common descent is testable and one of the most thoroughly tested scientific theories there are.   

    Can you even produce a testable hypothesis that is exclusive to common ancestry?

     That depends on what you mean by “exclusive”. The fact that the observed similarities and differences between organisms correspond to nested hierarchies is compatible with the statement “an unknown number of unknown designers used unknown means to produce this pattern at unknown points in time for unknown reasons” (which is trivially true because no conceivable observation could contradict that statement). However, common descent is not only compatible with this observation, it requires it (i.e., would be falsified if the observation would not correspond to nested hierarchies). Common descent has been proven beyond any reasonable doubt because it passed countless such tests where only a tiny subset of possible observations are consistent with the hypothesis that common descent is true while the remaining observations would have refuted the hypothesis. 

    How about tat hypothsis based on  the ToE’s mechanism of accumulations of genetic accidents?

    Semantic nonsense.

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    This is why we are priveleeged to have an evolutionary biologist writing here at ATP. Thanks Andy, Also, I was likewise confused by a couple of his demands!

  • frisbee_kid

    My point of the links is what I said is borne from peer-reviewed science, Jonathan. The articles say that there are preferred insertion sites, ie insertion and integration is NOT random.

  • frisbee_kid

    Jonathan- all the alleged positive evidence for universal common descent can be used as positive evidence for universal common design. And common design is something we humans have a great deal of experience with.

    So a common design explains the similarities quite nicely and different design requirements explains the differences observed. OTOH your “evidence” only explains the similarities and you have nothing to explain the differences and no way to measure it.

    Again a lizard evolving into a lizard doesn’t help you. Guppies becoming guppies doesn’t help you. BTW the Italian lizard is a beautiful example of “built-in responses to environmental cues” ala Dr Lee Spetner in “Not By Chance”.

    Also I noticed that you didn’t answer anything I said about how many mutations it takes to get a new body part and new body plans.

    And you didn’t even provide any testable hypotheses. IOW it is obvious that universal common descent is a case of “It looks like universal common descent to me”, and that ain’t science.

    And I don’t have any religious beliefs.

  • frisbee_kid

    The fixation probability can be precisely calculated and is a consequence of the selection coefficient, recombination rates and effective population size.

    All of which we do not know.

     

    In species with very low effective population sizes (which includes all mammals), neutral and even slightly deleterious mutations can, and are, fixated in the population.

    Real world examples, please.


    But anyway, what we find today are NOT complete and intact ERVs. We find remnants of what we think were ERVs, ie they “look like” ERVs. IOW we don’t know if what appears to be parts of an ERV were actually even ever part of an ERV.

    This is kind of like arguing that a corpse, which was identified to be Mr. Smith by DNA profiling, fingerprints and dental records, might not actually be Mr. Smith because “we found only remnants that look like Mr. Smith”.

    Just cuz you say so doesn’t make it so.

    We actually know very well which parts belonged to retroviruses, we can even reconstruct what they looked like and reconstruct an infectious retrovirus from the remnants that are still observable in our genomes.

    Venter reconstructed an entire genome from a computer file. IOW reconstruction doesn’t mean anything. A virus can be synthesized easily from parts that were never a virus.

    Universal common descent is testable and one of the most thoroughly tested scientific theories there are.  

    How is it testable? How many mutations did it take to get an upright biped from a knuckle-walker/ quadraped? How can we measure the claim?

    How can we test the claim that any bacterial flagellum can evolve via natural selection and/ or genetic drift and/ or luck?

    As for nested hierarchies- LoL!. The fact that the theory of evolution posits a gradual change, which means there would be many, many transitional forms, it is clar that the theory does not expect a nested hierarchy based on traits. Transitional forms by definition means there would be organisms with a ixture of defining traits, which would ruin a nested hierarchy based on traits.

    Also the observed nested hierarchy that is based on traits was based on a common design.

     


    How about tat hypothsis based on the ToE’s mechanism of accumulations of genetic accidents?

    Semantic nonsense.

    No, it is reality. And a reality I have supported many times. Mayr supports it. James Shapiro writes about it in “Evolution- a view from the 21st century”.

  • Andy_Schueler

    The articles say that there are preferred insertion sites, ie insertion and integration is NOT random.

    The word “random” is ambigous. People usually use it to mean “being or relating to a set or to an element of a set each of whose elements has equal probability of occurrence” (i.e. a uniform probability distribution). Rolling an unfair dice, which rolls a 6 with 50% probability and 1,2,3,4,5 with 10% probability each, would NOT be a random event based on this definition, although it is still clearly a stochastic event (again, “random” is ambigious, íf you use the other meaning “relating to, having, or being elements or events with definite probability of occurrence” – it would apply).  
    The same applies to the integration of ERVs, it is random, but NOT with a uniform probability distribution. 

  • Andy_Schueler

    Jonathan- all the alleged positive evidence for universal common descent can be used as positive evidence for universal common design.

    Wrong, there can be no positive evidence for “universal common design” because “design” is never specified, which means that no conceivable observation can contradict it (i.e. ANY conceivable observation is compatible with it) but no observation can provide positive support for the hypothesis as well. 
     

    So a common design explains the similarities quite nicely 

    A hypothesis that is consistent with any conceivable observation explains nothing. The explanatory value of ID is exactly equal to 0. 

     OTOH your “evidence” only explains the similarities and you have nothing to explain the differences and no way to measure it.

    Your ignorance about even the most basic evolutionary concepts is amazing. The differences in character states (be they morphological or molecular or behavioural etc.) is in fact the signal that methods for phylogeny inference are based on. We measure it, we explain it – you just flunked high school biology (it´s always funny to see people who are scientifically illiterate but feel confident enought to disprove entire disciplines, you are nicely illustrating the Dunning-Kruger effect).

    And you didn’t even provide any testable hypotheses. IOW it is obvious that universal common descent is a case of “It looks like universal common descent to me”, and that ain’t science.

    It is obvious to you, because you are scientifically illiterate. To give you just two examples, common descent strictly requires that patterns of similarities and differences correspond to nested hierarchies (common design requires no such thing and in fact, the cars built by one manufacture (to give one example) do not correspond to a nested hierarchy of similarities and differences). How well the signal within a dataset (for example a protein alignment) corresponds to a nested hierarchy can be precisely tested and this has been done literally(!) thousands of times by now (one of the earlier examples using molecular  data: http://mbe.oxfordjournals.org/content/3/5/403.long ).
    Another testable hypothesis would be the congruence of phylogenetic signal derived from independent methods. If universal common descent is true, phylogenies derived from different methods must be congruent within the limit of method accuracy (while common design requires no such thing at all). And this is indeed what we observe ( http://sysbio.oxfordjournals.org/content/42/2/126.abstract )  
    One could fill entire books with the testable hypotheses that common descent has passed, and indeed these books do exist. 

  • Andy_Schueler

    All of which we do not know.

    For primates, the selection coefficient would be very hard to determine precisely without some extremely unethical experiments, but getting a good approximation based on results from mice and rats is possible and recombination rates and effective population size can also be assessed reliably. So actually, all of this we do know with pretty good accuracy.

    Real world examples, please.

    http://mbe.oxfordjournals.org/content/13/1/209.short

    But anyway, what we find today are NOT complete and intact ERVs. We find remnants of what we think were ERVs, ie they “look like” ERVs. IOW we don’t know if what appears to be parts of an ERV were actually even ever part of an ERV.

    Just cuz you say so doesn’t make it so.

    I explained exactly why this is bullshit and your reply “Just cuz you say so doesn’t make it so” – is the intellectual equivalent of throwing your feces at your opponent.  

    Venter reconstructed an entire genome from a computer file. IOW reconstruction doesn’t mean anything. A virus can be synthesized easily from parts that were never a virus.

    So your argument is essentially “the genome Venter synthesized only looks exactly as a copy of the genome of a Mycoplasma genitalium strain, that doesn´t mean that it is a copy!” ?
    As I said, this is just as ridiculous as arguing that a corpse, which was identified to be Mr. Smith by DNA profiling, fingerprints and dental records, might not actually be Mr. Smith because “we found only remnants that look like Mr. Smith, that doesn´t mean that this corpse actually was Mr. Smith”.

    How is it testable?

    I gave you already two specific examples where common descent strictly requires that experimental observations correspond to tiny subset of all possible observations, while “common design” would be compatible with all conceivable observations. I could extend this list arbitrarily. 

    As for nested hierarchies- LoL!. The fact that the theory of evolution posits a gradual change, which means there would be many, many transitional forms, it is clar that the theory does not expect a nested hierarchy based on traits. Transitional forms by definition means there would be organisms with a ixture of defining traits, which would ruin a nested hierarchy based on traits.

    You clearly have either no idea what a “nested hierarchy” is or you have no idea what a “transitional form” is, or both (you could have looked it up instead of making a fool out of yourself (again)). Neither nested hierarchies nor transitional forms allow for an arbitrary mixing of characters, in fact, they strictly require a correlation between characters that corresponds to tree-like patterns (while common design requires no such pattern). 

    Also the observed nested hierarchy that is based on traits was based on a common design.

    So your hypothesis is that an unknown number of unkown designers caused the patterns that led to these hierarchy by unknown means at unknown points in time for reasons that are completely unknown except for the fact that the designers apparently wanted to make sure that the distribution of similarities and differences strictly corresponds to the tiny subset of observations that is compatible with universal common descent ? 

    No, it is reality. 

    No, “How about tat hypothsis based on the ToE’s mechanism of accumulations of genetic accidents?” is semantic nonsense, it is not even a complete sentence. 

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    Also, it appears that ERVs have preferred integration sites, which means similar organisms can be infected at a similar locus without any common ancestry connection.

    As evolutionary model states:

    d) The fourth common response is to understate the number of ERVs in identical loci, and to use that number in conjunction with target site preference. The argument is as follows:There are only a few ERVs found in identical loci in both humans and chimpanzees. Given target site preference, it is not unlikely that they are the result of infections in separate lineages. Thus the sharing of ERVs is constant with uncommon ancestry.
          It is not unreasonable to hypothesize that among the tens of thousands of ERVs, similar target site preference may have resulted in a very small percentage of instances of insertion, endogenization, and fixation in identical loci in two separate lineages.      But the first problem with the idea that this renders uncommon ancestry plausible is that there are ERVs shared by many more than just two lineages. For instance, there are ERVs shared by chimpanzees, humans, gorillas, orangutans, gibbons, and Old World Monkeys (Kurdyukov et al., 2001;Lebedev et al., 2000). The second problem—and by far, the most important—is that we do not share only a few ERVs in identical loci with Chimpanzees; examination of indel variation, and whole-genome analysis shows that we share virtually all of them with Chimpanzees. This is discussed extensively in the “Amount of Shared ERVs” section, above.
    http://www.evolutionarymodel.com/ervs.htm#ERV_Predictions

  • Andy_Schueler

    And it´s not only the phylogenetic signal from the insertion profile. The DNA sequences of the ERVs themselves as well as the flanking LTR regions can be aligned and give a phylogenetic signal that also supports the established phylogeny. Overall, they really are a pretty good phylogenetic marker .

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    This seems to be a case of a non-expert thinking he knows more than he does and coming up against someone who is empirically more knowledgeable on the subject, and the former being exposed. Badly.

  • JohnM

     I love how people always attempt to prove macro evolution, by pointing to micro evolution..

    Look guys.. Not even a bible belt red-neck would question, that his children inherit some of his traits. Neither would he question, that his cows and sheeps can be breed to promote certain traits among them..

    The whole evolution discussion is about macro evolution, Mkay?

    You know.. Dinosaurs becoming birds.. That sort of crazy stuff…

    And as for some organism sharing parts of the same DNA “source code”. That’s exactly what we would expect from a design perspective. It’s called design patterns

  • Andy_Schueler

     I love how people always attempt to prove macro evolution, by pointing to micro evolution..

    Always when one thinks that you simply cannot get any dumber…. Macroevolution is evolution at, or above the species level. The OP and the entire comment thread have been about nothing but distributions of traits at, or above the species level.
    Idiot. 

    And as for some organism sharing parts of the same DNA “source code”. That’s exactly what we would expect from a design perspective. It’s called design patterns

    DNA is not a “source code” and the idea that the evidence supports “common design” just as much as common descent is completely idiotic and was debunked in the very thread you are commenting on.

  • JohnM

    DNA is not a “source code”

    http://www.youtube.com/watch?v=CamNoA6Cfjc

  • Andy_Schueler

    Yeah, let´s ask the evangelical journalist and the evangelical philosopher to explain DNA to the guy that actually studied Molecular Biology!
    Idiot. 

  • JohnM

     http://en.wikipedia.org/wiki/Ad_hominem

  • Andy_Schueler

    My reply to you would have been an ad hominem fallacy if you had actually made an argument.
    But you didn´t. You simply posted random youtube crap and I´m not wasting time listening to a journalist trying to school me on Molecular Biology. If you think you have an argument, make it yourself or point to an authorative source (hint: that does not include UfoTV, the Wolrdnutdaily or Conservapedia).   

  • JohnM

    Uh uh.. Shaky world-view armour about to crumble. Must not listen to other side. Cannot handle it.

  • Andy_Schueler

    Right, every time a random scientifically illiterate crackpot shows up who tries to disprove a spherical shape of the earth, geocentrism, evolution, Cantor´s diagonal proof, general relativity or the holocaust – all experts in the relevant fields should immediatly pay attention and “listen to both sides”.

    Come up with an argument that has not been debunked a few thousand times and we can talk. 

  • JohnM

    Oki, let’s get technical then…  You claim that DNA is not a “source code”.

    Are you really telling me, that you, as a wannabe computer programmer, cannot even see the link between these two?

    http://i172.photobucket.com/albums/w28/SweatyYeti/Fun/DNABinaryCode1.jpg

  • Andy_Schueler

    See, and that´s why I call you an idiot. 
    You think:
    GATCATGCTGATGCT
    10101010000101010101111110100111001
    is an argument. Ergo, you are an idiot – QED.

    Oki, let’s get technical then…

    => This:

    GATCATGCTGATGCT
    10101010000101010101111110100111001

    is “technical” for you ? 
    Cute. 

    Are you really telling me, that you, as a wannabe computer programmer,

    You really want to go there or there again ?

  • JohnM

     Don’t go crazy now. Just retract your comment, and own up to your mistake, silly.

  • Andy_Schueler

    I take it that you have no “argument” beyond:
    GATCATGCTGATGCT10101010000101010101111110100111001
    which obviously proves that DNA is just like the source code for a computer program. Idiot.

    As an educational exercise, you could try to write up a list of all the similarities and differences between DNA and computer code – but since you are completely clueless about both, this will be quite the challenge for you.

  • JohnM

    I take it that you have no “argument” beyond:
    GATCATGCTGATGCT10101010000101010101111110100111001
    which obviously proves that DNA is just like the source code for a computer program.

    Well obviously it’s not “just like” binary code, as one take the form of ACTG while the other take the form of 01.

    But then again, I never said that it was “just like” source code for a computer program. So what’s your point? You don’t have one. You’re just grasping at straws.

    So how does it feel like, getting complete owned by an “idiot”? Maybe we should call in Jonathan for some moral support? Have him come and massage your fragile little ego, and tell you how you completely owned me?

  • Andy_Schueler

    Well obviously it’s not “just like” binary code, as one take the form of ACTG while the other take the form of 01.

    And except for that, they are obviously completely analogous! Idiot. 

    But then again, I never said that it was “just like” source code for a computer program. So what’s your point?

    You said “And as for some organism sharing parts of the same DNA “source code”” – I pointed out that DNA is not “source code”. Try to write up a list of the similarities and differences between DNA and the source code of a computer program – the list of differences is much longer than the list of similarities. 

    So how does it feel like, getting complete owned by an “idiot”? 

    Yes, behold your awe inspiring knowledge and understanding of Molecular Biology and Computer Science:
    http://i172.photobucket.com/albums/w28/SweatyYeti/Fun/DNABinaryCode1.jpg

    Idiot. 

  • JohnM

    Idiot.

    Well I hope such comments makes you feel better about yourself.

    It sure does make you look a whole lot more mature.

    After all, you’re representing the rational, rather than the emotional side of things, aren’t you?

  • Andy_Schueler

    Would you prefer “mentally deficient” ? 
    You are an idiot and you are a liar, deal with it (or stop lying and get an education). 

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    If I labelled men as 0 and women as 1 and created a linear distribution, does that make humans a source code?

  • JohnM

    No, that would just be random numbers, with no meaning behind them.

    What’s so special about the double helix, is that it’s an information carrier, with a 4 character digital code, aka an information langauge, which contains instructions ( or code ) for building protein machines, cells, hearts, lungs and just about every living thing.

    Think about it as form of morse code orders, or a blueprint for a building, stored on a microfilm string.

    … _ _ _ …

    S O S

    Is that just random bip’ing sounds?

    Or someone trying to relay information to you?

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    But any code which I decide represents something, carries information. This does not exempt natural instances of patterns which I can then ascribe code to. A distribution of male to females int eh world is not too dissimilar to AGCT distribution on a helix, conceptually.

    AGCT is only ‘code’ because we ascribe code to it. That is an abstract pastime. Those names don’t exist, per se. AGCT are not objective entities. They are abstract labels ascribed to matter which happens to form patterns naturally. I can ascribe ‘code’ (and we do) to all different acids, eg H2SO4. It is in a pattern due to the laws of nature.So your argument should not be about DNA vs binary source code, but why ANYTHING should have pattern.I have written an essay on this:http://www.skepticink.com/tippling/essays-and-papers/the-argument-from-format-how-the-cartesian-soul-cannot-be-the-originator-of-free-will/About how any existence must have law like ontology, which will in turn promote patterns.

  • Andy_Schueler

    What’s so special about the double helix, is that it’s an information carrier, with a 4 character digital code, aka an information langauge, which contains instructions ( or code ) for building protein machines, cells, hearts, lungs and just about every living thing.

    Think about it as form of morse code orders, or a blueprint for a building, stored on a microfilm string.

    The information for the primary structure of proteins indeed comes from DNA. But DNA contains nothing like an “instruction set” as machine code does.The information to build cells, tissues, organs etc. is not stored in DNA, there is no “instruction” that refers to “build four five-digit limbs” anywhere in our genomes. Organismal development is based on the interaction of genes, environment and chance and cannot be reduced to any of these components. 

    Think about it as form of morse code orders, or a blueprint for a building, stored on a microfilm string.

    Wrong. The “DNA -> blueprint” analogy is already not a very good one when it only refers to DNA being a “blueprint” for proteins. But “blueprint” for the organism is simply wrong – there is no such thing as a “blueprint” for an organism. Why that is so is hard to understand without an introduction to developmental biology, but it´s possible to get an intuitive grasp of why it cannot be a blueprint for the organism even without any knowledge of developmental biology. Consider these two examples:1. Monozygotic twins share genes and environment – they still do not develop into identical organisms (and the differences are not only behavioural, they also have different fingerprints and can have different heights etc.) 2. That our genome cannot be a “blueprint” for an adult human was already well known long before we actually sequenced it. We knew that the genome size was roughly 3 billion basepairs, but we also knew that an adult human brain is composed out of 100 billion neurons with 100 trillion neural connections between them – so even if the genome would just be a “blueprint” for the brain, it would still be many orders of magnitude too small to describe it.   

  • frisbee_kid

    Wrong, there can be no positive evidence for “universal common design” because “design” is never specified,

    Yes, it is. Your ignorance means nothing to me, Andy.

    which means that no conceivable observation can contradict it (i.e. ANY conceivable observation is compatible with it) but no observation can provide positive support for the hypothesis as well.

    yet we have said exactly what would contradict it. Nice to see that you are also ignorant of science.

    BTW it is a safe bet that you don’t know what a nested hierarchy is.

  • frisbee_kid

    ERVs-
    endogenous retrovirus- meaning remnant, ie bits and pieces, leftovers of once
    intact invading viruses.

    The claim is
    that these alleged ERVs are evidence for common ancestry, for example between
    humans and all other primates, because these ERVs are found in identical loci
    throughout primate genomes.

     

    The thinking
    is that some gamete became infected and this was then passed down via
    successful mating with that gamete. Then that became fixed in the population,
    somehow. However before all that the virus had to become disabled- or maybe
    just inserting into a gamete’s genome that disables it. If it doesn’t its
    replication process would eventually destroy the invaded gamete.

     

    So we have
    these bits and pieces of alleged ERVs, bits and pieces because the original
    virus became disabled and then scrambled. Scrambled enough to disable and cut
    it up but luckily not scrambled enough so that we cannot identify it and use it
    as a genetic marker- yeah right.

     

    The problem
    is that some or even most of these alleged ERVs have known functions in our and
    the other primates’ genomes. The “answer” to that is “it evolved”.

    The “answer”
    to the alleged ERVs being actual ERVs is that scientists have taken these
    remnants, spliced them together to make a working virus. To me that is evidence
    that the virus itself is derived from a dead and decaying animal.

     

    IOW it looks
    like we have many ERVs because the virus came from those DNA sequences.

  • frisbee_kid

    Venter reconstructed an entire genome from a computer file. IOW reconstruction doesn’t mean anything. A virus can be synthesized easily from parts that were never a virus.

    So your argument is essentially “the genome Venter synthesized only looks exactly like a copy of the genome of a Mycoplasma genitalium strain, but that doesn´t mean that it is a copy!!” ?

    Nope, not even close. My argument is that totally unrelated nucleotides can be spliced together to form a virus or the genome of some bacterium.

    You clearly have either no idea what a “nested hierarchy” is or you have no idea what a “transitional form” is, or both (you could have looked it up instead of making a fool out of yourself (again)).

    LoL! It is a given that I understand nested hierarchies better than you.

    And BTW Andy, the ToE posits accumulations of genetic accidents as its mechanisms. Ya see according to the ToE ALL genetic change is an error/ mistake/ accident- nothing was planned, nothing was directed. And if you can’t even grasp that simple fact then you don’t know Jack about evolutionism.

  • JohnM

     

    Andy Said : The “DNA -> blueprint” analogy is (unfortunately) widely used…

    Nice addition… Unfortunately for you, I read what you first wrote, this morning. Ups!

    Andy Said : Monozygotic twins share genes and environment – they still do not develop into identical organisms

    There’s a huge difference between design and execution. You may build 5 houses using the same blueprint, but that doesn’t mean, that you’ll end up having built 5 identical houses. Mkay?

    Andy Said : there is no such thing as a “blueprint” for an organism.

    There are black Audi TT’s and there are white Audi TT’s. There are even orange Audi TT’s. Some have custom rims. Some have huge spoilers. But they are all Audi TT’s. Why?

    Because they are all build according to the same blueprint. If they weren’t, there wouldn’t be any Audi TT’s around. There would only be random cars.

    So maybe you should spend some time contemplating, how and why you’re able to distinguish between a pig and a human being. And why there are such things as pigs and human beings in the first place, rather than just a bunch of random living creatures. Mkay?

    Andy Said : Organismal development is based on the interaction of genes, environment and chance and cannot be reduced to any of these components.

    Sigh… Chance..  Let me get this straight..  So you actually think, that it’s down to chance, that we all turned out to be humans?

    And sure.. Human beings in environments such as Africa and Asia, does look a bit different than the ones living in Europe. But they are still human beings, right?

    Even a half-brain-dead person, can see that there’s a blueprint for how humans are build. So you are doing nothing more, than denying the obvious. And I seriously don’t understand, why you even bother.

  • Andy_Schueler

    Yes, it is. Your ignorance means nothing to me, Andy.

    A theory that cannot be contradicted by evidence can also not be supported by evidence. It´s really not very complicated. 

    yet we have said exactly what would contradict it.

    No, we did not.

    BTW it is a safe bet that you don’t know what a nested hierarchy is.

    I explained it in detail and my explanation follows the established definitions in textbooks and the scientific literature. Your response would need several promotions to be regarded as a silly tu quoque. 

  • Andy_Schueler

    Already refuted two days ago.

    By simply copy-pasting your earlier comment, without having the common decency of even trying to address the refutation (you did not even correct the formatting FFS), you demonstrate that you are nothing but a dishonest troll. 

  • JohnM

    Jonathan Said : But any code which I decide represents something, carries information.

    No, that’s turning the thing on its head. Junk in, junk out. You cannot extract information from junk. And as I’m sure you’re aware of, due to the wonders of probability, we know that a universe full of monkeys, typing randomly, has no chance of producing a shake-spears play.

    And yes Jonathan, please go ahead and introduce a head monkey and a target phase. I love when Richard Dawkins completely owns himself, by introducing a designer head monkey, to determine what he want the outcome to be, to prove, that blind chance can generate information.

    Jonathan Said : AGCT is only ‘code’ because we ascribe code to it. That is an abstract pastime. Those names don’t exist, per se. AGCT are not objective entities.

    It’s not about the labels. The labels are irrelevant. They could have labelled them 0 1 2 3, it would have made no difference. The information is not in the labelling, but in the sequencing.

    Jonathan Said : They are abstract labels ascribed to matter which happens to form patterns naturally.

    That’s like saying, that a page in a newspaper could have formed naturally, by someone accidentally spilling ink on a white paper.

    There is a chemical explanation for why ink stick to paper. But that does not explain how the ink got arranged, to convey a message that could be understood by speakers of the English language.

    Information requires a material medium, but it transcends the material medium.

    ( And yes, I Am quoting the youtube movie that I linked, that you didn’t bother to watch )

  • Andy_Schueler

    Nope, not even close. My argument is that totally unrelated nucleotides can be spliced together to form a virus or the genome of some bacterium.

    Nucleotides are not “related” or “unrelated” anymore than a two water molecules are “related” or “unrelated”. You might have been thinking of genes / genomes, but this sentence would still have no logical connection to anything that was argued so far. 

    LoL! It is a given that I understand nested hierarchies better than you.

    Of course you do sweetie! You understand them so well that you posted this comment earlier:
    “As for nested hierarchies- LoL!. The fact that the theory of evolution posits a gradual change, which means there would be many, many transitional forms, it is clar that the theory does not expect a nested hierarchy based on traits. Transitional forms by definition means there would be organisms with a ixture of defining traits, which would ruin a nested hierarchy based on traits.”
    => and by posting such ignorant ramblings that demonstrate not even a superficial understanding of either transitional fossils or nested hierarchies, you obviously wanted to make us think you actually understand them very well and justed wanted to provide some comic relief.
    That´s totally plausible!

    And BTW Andy, the ToE posits accumulations of genetic accidents as its mechanisms. Ya see according to the ToE ALL genetic change is an error/ mistake/ accident- nothing was planned, nothing was directed. And if you can’t even grasp that simple fact then you don’t know Jack about evolutionism.

    And yet another sentence that is not even tangentially related to any topic that was discussed so far. 
    If you cannot stay on topic, you should look for a different hobby.

  • Andy_Schueler

    Nice addition… Unfortunately for you, I read what you first wrote, this morning. Ups!

    Which was different how ? 

    There are black Audi TT’s and there are white Audi TT’s. There are even orange Audi TT’s. Some have custom rims. Some have huge spoilers. But they are all Audi TT’s. Why?Because they are all build according to the same blueprint. If they weren’t, there wouldn’t be any Audi TT’s around. There would only be random cars.

    Read my comment before you reply. 

    So maybe you should spend some time contemplating, how and why you’re able to distinguish between a pig and a human being. And why there are such things as pigs and human beings in the first place, rather than just a bunch of random living creatures. Mkay?

    No logical connection whatsoever to anything I wrote. 

    Sigh… Chance..  Let me get this straight..  So you actually think, that it’s down to chance, that we all turned out to be humans?

    No, read my comment. 

    And sure.. Human beings in environments such as Africa and Asia, does look a bit different than the ones living in Europe. But they are still human beings, right?

    No logical connection whatsoever to anything I wrote.

    Even a half-brain-dead person, can see that there’s a blueprint for how humans are build. So you are doing nothing more, than denying the obvious. And I seriously don’t understand, why you even bother.

    There is no blueprint for humans.

  • Andy_Schueler

    No, that’s turning the thing on its head. Junk in, junk out. You cannot extract information from junk. And as I’m sure you’re aware of, due to the wonders of probability, we know that a universe full of monkeys, typing randomly, has no chance of producing a shake-spears play.

    No logical connection to anything that was argued so far.

    And yes Jonathan, please go ahead and introduce a head monkey and a target phase. I love when Richard Dawkins completely owns himself, by introducing a designer head monkey, to determine what he want the outcome to be, to prove, that blind chance can generate information.

    It´s a toy example that has little to do with the real world except for demonstrating the difference that cumulative selection makes. It was described as a toy example by Dawkins and he laid out the long list of differences to a real-world scenario. 
    It is telling that creationists have nothing better to do than lie about the context in which example was used and don´t even try to address the scientific literature on this topic.
    Hint: the “METHINKSITISAWEASEL” program was never part of a scientific paper – it was part of a book targeted at an audience with no scientific background, it was also never described as a “simulation of evolution”, and the differences to a real-world scenario were precisely explained by Dawkins.

    Information requires a material medium, but it transcends the material medium.

    Bullshit.

  • JohnM

    Andy Said : Which was different how ?

    Well you tell em.. It was your embarrassing mistake..  So damaging that “some people” may have gotten the idea, that you’re not even a biologist, as no biologist would have made that kind of mistake…

    Right now, all people can see, is that it was posted 12 hours ago, and Edited by author 9 hours ago.

    Did it really take 3 hours for you to fix a typo? Or did you discover something, in the 3h you spent google’ing?

  • Andy_Schueler

    I added that part about metaphors:

    “Metaphors are useful, but only when one understands their limitation. The only genetic “blueprint” their is, is a “blueprint” for protein primary structures and gene expression profiles – there is no “blueprint” for protein structure above the primary structure level, there is no “blueprint” for assembling a cell, there is no “blueprint” for assembling tissues and there is no “blueprint” for assembling organs.”

    Well you tell em.. It was your embarrassing mistake..  So damaging that “some people” may have gotten the idea, that you’re not even a biologist, as no biologist would have made that kind of mistake…

    By all means, reveal my “embarrassing mistake demonstrating that I´m not even a Biologist”! (hint: Jonathan knows where I work and I´m not that hard to find). 

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    1) Define blueprint

    2) Define information

    I imagine your argument comes down, really, to scientific laws. Because you are talking about the effects – the patterns. But you are arguing at the wrong level, because you don;t REALLY grasp what you are arguing.

    Your argument should be “why are there laws rather than no laws?”

    or

    “Why is there something rather than nothing?”

    My essay I linked answered that first question.

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    Andy is an evolutionary molecular biologist. You and frisbee kid couldn;t have picked a better sparring partner. And it appears you are getting pwned.

  • JohnM

     Thanks for the moral support to Andy’s ego

  • Andy_Schueler

    1) Define blueprint
    2) Define information
    I imagine your argument comes down, really, to scientific laws. Because you are talking about the effects – the patterns. But you are arguing at the wrong level, because you don;t REALLY grasp what you are arguing.

    You read that JohnM ? That´s precisely your problem. 
    You have the misconception that the DNA of an organism contains any information beyond the information about protein primary structures and information related to DNA folding and gene expression – it doesn´t.
    Once the information flow from DNA to protein is complete, everything that follows is natural laws in action. DNA doesn´t describe cells, tissues, organs etc. It doesn´t even describe the three dimensional structure of proteins, this:
    http://en.wikipedia.org/wiki/Schr%C3%B6dinger_equation
    does.

  • Andy_Schueler

     Thanks for the moral support to Andy’s ego

    Sorry to disappoint you but my ego is not threatened by either your dishonesty or your ignorance – the former disgusts and the latter amuses me.

  • JohnM

    That’s great Andy.

    On one hand, you want us to believe, that DNA doesn’t really describe anything. It mostly comes down to chance and the environment…

    On the other hand, you want us to believe, that mutations in DNA, is the diving force behind evolution.

    Don’t you get it? You’re messed up big time.

  • Andy_Schueler

    Your ignorance continues to amaze. You cannot even quote anything we said and ask for clarifications or try to rebut – you seem to be unable to reply to anything but your own misconceptions. 

    On one hand, you want us to believe, that DNA doesn’t really describe anything. 

    No, that´s not what I said. I said that DNA contains the information for the primary structure (and only the primary structure) of proteins (hint: “primary structure” is the linear sequence of amino acids in a protein) and information connected to gene expression. 
    If you don´t understand that, explain what specifically you do not understand instead of arguing against your own misconceptions.  

    It mostly comes down to chance and the environment…

    No, that´s also not what I said. I said that organismal development is an interplay (mediated by natural laws as expressed in the Schrödinger equation for example) of genes, environment and chance and cannot be reduced to any of those three components
    Again, if you don´t understand that, explain what specifically you do not understand instead of arguing against your own misconceptions.  
    I could walk you through a specific example like protein folding or determination of fingerprints – but for that, you´d have to show some humility and acknowledge that this is a topic of which you currently know nothing except for a long list of misconceptions. 

    On the other hand, you want us to believe, that mutations in DNA, is the diving force behind evolution.

    I don´t care what you believe. Whether you believe in common descent or any evolution-related topic is completely irrelevant to me because you are currently too ignorant to have an informed opinion. I care about your opinion regarding evolution just as much as I care about Paris Hilton´s opinion regarding dark energy.

  • JohnM

    Do you, or do you not believe, that mutations in DNA, play a major role in shaping the organism / living creature?

  • Andy_Schueler

    Do you, or do you not believe, that mutations in DNA, play a major role in shaping the organism?

    “Believe” is the wrong word, it´s undeniably true.

  • Andy_Schueler

    deleted – double post

  • JohnM

    So in other words, you do think that DNA is a blueprint. You just want to leave the 0.1% to blind chance, in case a mutation occur during production?

  • Andy_Schueler

    But I think I understand now where the root of this particular misconception of yours is. 
    Consider the crystallization of water, some examples:
    http://upload.wikimedia.org/wikipedia/commons/c/c2/SnowflakesWilsonBentley.jpg

    Do H2O molecules contain the information about the possible crystal structures ? 
    No, they do not. 
    The crystal structure is the outcome of the interaction (mediated by natural laws) of water, environment and chance. 

    Does this mean that the nature of the crystallizing molecules is irrelevant for the possible crystal structures ? 
    Of course not.
    Replacing water by formic acid (HCOOH) would lead to a different interaction of molecules, environment and chance. 

    The way particular molecules behave cannot be understood without considering environment and chance – those three things are intrinsically connected. And that is the source of your confusion. 
    DNA contains information about which amino acids to assemble in linear order by the ribosomes. What happens to the protein afterwards is the outcome of the interaction of this molecule with environment and chance (mediated by natural laws as expressed in the Schrödinger equation for example).
    That´s why mutations / changes in the genotype are highly relevant for the phenotype – although DNA contains no information about the phenotype whatsoever beyond protein primary structures and information related to gene expression. 

    Is this clear or are you still confused ? 

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    Define blueprint
    Define information

  • Andy_Schueler

    So in other words, you do think that DNA is a blueprint. You just want to leave the 0.1% to blind chance, in case a mutation occur during production?

    No, that´s not even remotely similar to anything I said. 
    You keep on arguing against your own misconceptions. 

    I explained it again in a way that even a complete idiot should be able to understand:
    http://www.skepticink.com/tippling/2013/02/15/endogenous-retroviruses-as-evidence-for-evolution/#comment-803296891

    Btw, as Lao Tzu said:
    The wise man is one who, knows, what he does not know.”
    => you have no grasp about the limits of your understanding, that makes you an idiot – and you simply cannot honestly address what we actually said and instead put words in our mouth, that makes you an ass. 

    Complain about the lack of civility all you want – you deserve no other labels.

  • JohnM

     As defined in the youtube movie i linked, Jonathan,

  • JohnM

     Lol! What the… Crystals?!

    What does that have to do with DNA?

    Nothing. You just posted a whole lot of nothing.

  • Andy_Schueler

    So far I thought that you were simply dishonest, uneducated and obnoxious. 
    But you seem to be actually mentally retarted. That is nothing to be ashamed of, but it´s still no excuse to act like an ass.

  • JohnM

    But that’s just empty words. If I really were a retard, then you wouldn’t be wasting your time on me. So at least think your replies though, before you post your gibberish.

  • Andy_Schueler

    As I said, until your last comment, I thought that you were merely dishonest, uneducated and obnoxious. 
    Since then I´m convinced that you are mentally retarted. 

  • JohnM

    Then stop wasting your time

  • Andy_Schueler

    Will do. I´d ask you though to cease commenting on any of the posts that I submit and to not reply to any of my comments in other threads. 
    It´s clearly a waste of time to try to reason with you – but I will not leave your nonsense uncorrected if you spew it in response to any of my posts or comments. 

  • JohnM

    I’m more than happy to continue.

    It’s you who has to stop, if you want to be consistent, with all the gibberish that you’ve just said.

    You’ve basically cornered yourself. And congrats on that.

  • Andy_Schueler

    Well, it´s more like trying to teach geometry to a chimp. Your lack of education could be dealt with by explaining the relevant material to you, but your lack of intelligence is an insurmountable obstacle. 

    If you are unable to grasp the concept that nucleic acids, amino acids and their polymers are molecules, and as such affected by the same natural laws that govern the behaviour of other molecules like water or formic acid – then there is  nothing to talk about. You literally (yes, literally) do not even begin to understand what the acronym “DNA” or the word “protein” refer to. 
    In other words, you try to argue that DNA is a blueprint for molecular machines, cells, tissues and organs. But since you don´t even begin to understand what DNA or molecular machines are (and by implication understand just as little – nothing – about cells, tissues and organs), your proposition has no meaning to any person that actually has some understanding of these concepts. 

    I´ll try to explain it with words that you might be more familiar with – imagine somebody tries to convince you that Jesus was never resurrected from the dead. You try to discuss with him and realize that this person thinks that the word “Jesus” refers to a microwave and the process “resurrection from the dead” refers to mitosis – and microwaves clearly do not undergo mitosis. Then you also realize that this person is unwilling to let go of his preconceived (and wrong) ideas that “Jesus” is a microwave – which would leave you with nothing to discuss. Because your opponent makes a proposition that is completely meaningless to you as someone who understands the relevant concepts and your opponent is also unwilling or unable to learn and correct his misconceptions. 

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    “ Lol! What the… Crystals?!
    What does that have to do with DNA?
    Nothing. You just posted a whole lot of nothing.”

    John, you are being really disingenuous here, you really are. Andy has taken the time to explain where you are misconceiving ideas, which you very clearly are. You cannot just dismiss it like that.
    You definitely need to detail what you mean by saying DNA is a blueprint containing information. I think your idea of the information it contains is wrong. You clearly see it as more than it is. Your comments drip with presupposition of agency and you refuse to even begin to understand how things might be able to exist without it.

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    John. Lay out conclusively what you believe DNA is, what you think it does and how. Lay out what you think naturalists think DNA is, what it does and how.

    From there, we can see if you know what you are talking about, and we can move this forward. Until you give us that information, this conversation can go no further.

  • JohnM

    Jonathan Said : Your comments drip with presupposition of agency…

    Of course. There is only one know cause for the origin of information, and that cause is intelligence. Be it a hieroglyphic inscription, a section of text in a book, or computer code.. If you have information, and you trace it back to the source, you come to an intelligence. Therefore, when you find information, inscribed along the back bone of the DNA molecule in the cell, the most rational inference, is that an intelligence of some kind, played a role in the origin of that information.

    And yes, once again I’m quoting the youtube movie, that you didn’t bother to watch.

  • JohnM

    John. Lay out conclusively what you believe DNA is, what you think it does and how.

    http://ghr.nlm.nih.gov/handbook/basics/dna

    The information in DNA is stored as a code made up of four chemical bases: adenine (A), guanine (G), cytosine (C), and thymine (T). Human DNA consists of about 3 billion bases, and more than 99 percent of those bases are the same in all people. The order, or sequence, of these bases determines the information available for building and maintaining an organism, similar to the way in which letters of the alphabet appear in a certain order to form words and sentences.

  • http://www.www.skepticink.com/tippling/ Jonathan MS Pearce

    “And yes, once again I’m quoting the youtube movie, that you didn’t bother to watch.”

    When you show that you can and have read the requisite links that Andy has provided, and the requisite reading for the topic, I will oblige.

    Please do not get your information on evolutionary molecular biology from people who are not experts in… evolutionary molecular biology.

  • Andy_Schueler

    Now you´ve apparently read an extremely brief and incomplete summary of what DNA is

    Now let´s get to what it does.

    This is a model of the structure of one protein (Acetylcholinesterase):
    http://www.rcsb.org/pdb/explore/explore.do?structureId=1acj
    inferred from experimental data about the 3-dimensional locations of individual atoms in an Acetylcholinesterase protein crystal:
    http://www.rcsb.org/pdb/download/downloadFile.do?fileFormat=pdb&compression=NO&structureId=1ACJ (file can be opened in any text editor).

    This is the corresponding mRNA sequence:

    ATGAACCTGCTGGTCACCTCTTCGCTGGGCGTGCTTCTGCACTTGGTCGTCCTGTGCCAGGCGGACGATCACTCTGAGCTCCTGGTCAACACCAAGTCGGGAAAAGTCATGGGAACAAGAGTCCCAGTCCTCTCCAGCCACATCAGCGCTTTCCTGGGGATTCCCTTTGCCGAGCCTCCAGTTGGGAACATGAGGTTCAGGAGACCTGAGCCCAAGAAACCGTGGTCGGGAGTCTGGAACGCTTCCACCTATCCCAACAACTGCCAGCAGTACGTTGACGAGCAGTTCCCTGGATTTTCAGGTTCAGAGATGTGGAATCCGAACAGAGAGATGAGTGAGGACTGTTTGTACCTCAACATTTGGGTGCCTTCTCCGAGGCCGAAGAGTACAACCGTCATGGTGTGGATCTACGGAGGCGGTTTCTACAGCGGGTCCTCGACGTTGGACGTCTACAATGGGAAATACCTTGCCTACACCGAGGAGGTGGTGC
    TGGTCTCTCTGAGCTACCGGGTGGGCGCTTTTGGTTTTCTCGCCCTCCACGGCAGCCAGGAGGCACCAGGAAATGTGGGCCTCCTGGACCAGAGGATGGCACTGCAGTGGGTGCACGACAACATCCAGTTCTTCGGCGGGGACCCCAAGACGGTGACCATCTTCGGAGAGAGTGCCGGCGGCGCCTCTGTCGGCATGCACATTCTCTCCCCGGGGAGCCGAGACCTCTTCCGCCGGGCCATCCTTCAGAGCGGCTCGCCCAATTGCCCGTGGGCGTCTGTCTCTGTTGCTGAAGGCCGCAGGAGGGCGGTCGAGCTGGGAAGAAACCTCAACTGTAACCTCAACAGCGACGAAGAGCTCATCCACTGTCTGAGGGAAAAGAAGCCTCAGGAGTTGATTGACGTGGAGTGGAATGTCCTTC
    CCTTTGACAGTATCTTCAGGTTCTCCTTCGTTCCCGTCATCGATGGGGAATTCTTCCCAACCTCCCTGGAATCTATGTTGAACTCTGGCAACTTCAAGAAGACTCAGATCTTACTGGGAGTCAACAAGGACGAGGGCTCGTTTTTCCTCTTGTACGGAGCGCCGGGTTTCAGCAAGGACTCTGAAAGCAAAATCTCTCGGGAAGACTTCATGTCAGGGGTCAAGCTAAGCGTTCCCCACGCCAATGACTTAGGGTTGGACGCTGTCACGCTACAGTACACAGACTGGATGGATGACAACAATGGTATAAAGAACAGAGATGGATTGGACGACATCGTAGGGGACCACAAC
    GTCATATGCCCCTTGATGCACTTTGTTAACAAGTACACCAAGTTTGGCAATGGCACCTACCTGTACTTCTTCAACCACCGAGCCTCAAACCTGGTGTGGCCGGAGTGGATGGGCGTCATCCACGGCTATGAGATTGAGTTCGTCTTCGGGCTGCCTCTGGTGAAGGAGCTGAACTACACAGCGGAGGAGGAAGCGCTGAGCCGGAGGATAATGCATTACTGGGCGACATTCGCAAAGACTGGAAACCCAAACGAACCCCCTCACAGGAGAGCAAATGGCCTCTCTTCACTACCAAGGAGCAGAAATTTATTGACCTCAACACAGAACCCATGAAAGTCCACCAGCGACTCCGAGTTCAGATGTGCGTGTTCTGGAACCAGTTCCTCCCCAAGCTCCTCAACGCCACAGAGACCATTGATGAGGCAGAACGCCAGTGGAAGACGGAGTTTCATCGGTGGAGTTCCTACATGATGCACTGGAAGAACCAATTTGACCACTACAGCAGACACGAGAGCTGTGCTGAGCTGTGA

    which contains all the information required by the Ribosomes to assemble all amino acids from the structure shown above in linear order.

    You seem to think that this sequence determines that structure and the behaviour of the protein molecule visualized above. It does not.
    The 3-dimensional structure is a product of the interaction (governed by natural laws as expressed in the Schrödinger equation for example) of the amino acids, the environment and chance (hint: a chance component does not mean what you apparently think it means – it does not mean that the resulting protein structure is randomized, it means that the quantum states of the individual atoms are described by probability distributions and that the folding pathway to the energetic optimum is not deterministic, but rather also described by probability distributions (not for lack of information, this is an intrinsical aspect of quantum physics)).

    In other words, what I said below about the behaviour of water and formic acid molecules in crystallization applies to proteins in the same way. 

    Before you can grasp that – there is nothing to discuss.

  • Andy_Schueler

    Of course. There is only one know cause for the origin of information, and that cause is intelligence.

    You are relying on creationist math. 
    Consider a population of individuals with one allele being distributed as such:
    A – 25%, T – 50%, G – 25%, C – 0%
    The entropy of this allele is thus 1.5 bits.

    Now we assume that one individual mutates at this allele to C, resulting in a net fitness increase. 
    After 100 generations, we reach:
    A – 1%, T – 1%, G – 1%, C – 97%

    And the resulting information increase corresponds to a  reduction of uncertainty from 1.5 bits to ~0.04 bits. 

    Actual math thus shows that natural selection indeed creates genetic information.

  • JohnM

    Andy said : Well, it´s more like trying to teach geometry to a chimp.

    http://www.newscientist.com/article/dn16744-chimps-use-geometry-to-navigate-the-jungle.html

  • Andy_Schueler

    Then let me correct that, it would probably be much easier to teach geometry to a chimp than to teach you on molecular biology. 

  • JohnM

    Andy said : Actual math thus shows that natural selection indeed creates genetic information.

    Yeah. Like monkeys typing randomly without a head monkey designer. Or someone spilling ink on a white paper, that happens to arrange itself in such a way, that it precisely match today’s newspaper.

    Three word for you: Blind Irrational Faith.

  • JohnM

    Andy Said : Before you can grasp that – there is nothing to discuss.

    I guess you didn’t really mean that one either?

  • Andy_Schueler

    And again, you demonstrate that you are a pathological liar.

    Yeah. Like monkeys typing randomly without a head monkey designer. Or someone spilling ink on a white paper, that happens to arrange itself in such a way, that it precisely match today’s newspaper.

    Let me demonstrate that you are lying:
    1. This gibberish is no way, shape or form related to the comment you replied (i.e. you are putting words in my mouth)
    2. We know from your earlier comments that you are aware that there is such a thing as “natural selection”.
    3. The selection component due to the fitness increase of the mutation in my example was clearly laid out, you read it – and you lie about what I said. 

    Why are you such a pathetic liar JohnM ? Why can you not defend your beliefs without lying all the time ? 

    Three word for you: Blind Irrational Faith.

    Four words for you:
    Pathetic, deplorable, lying scumbag.

  • Andy_Schueler

    I guess you didn’t really mean that one either?

    I mean that – we have nothing to discuss until you grasp the basic concepts. We can discuss this topic with you no more than you could discuss christianity with a guy that believes that “Jesus” is a microwave. 

  • Andy_Schueler

    Yeah. Like monkeys typing randomly without a head monkey designer. Or someone spilling ink on a white paper, that happens to arrange itself in such a way, that it precisely match today’s newspaper.

    Btw, I´ll retract “Pathetic, deplorable, lying scumbag.” as soon as you provide a quote from any evolutionary biologist who argued that evolution means the following:

    “1. Organisms have no common ancestor (“spilling ink on white paper” -> no descent with modification).

    2. Each individual is assembled by chance collisions of molecules and nothin but chance collisions of molecules, there are no natural laws – only random chance (Monkeys -> typewriter).

    3. Random chance thus produces perfect copies of pre-selected targets (“match todays newspaper” ).”

  • JohnM

    Andy said : Four words for you: Pathetic, deplorable, lying scumbag.

    Haha. Oki let’s leave it at that. Thanks for a fun discussion.

    Andy said : I´ll retract “Pathetic, deplorable, lying scumbag.” as soon…

    Uh uh… Blackmail! I surrender!

    Nah.. I couldn’t care less what names you call me.

    Besides, it’s clear from your own inconsistency, that you don’t really mean the things you say.

    Good night buddy

  • Andy_Schueler

    Haha. Oki let’s leave it at that.

    Nope, we´ll not leave it at that. We´ll add this to the big pile of lies, trolling and general assholery that you already accumulated on this blog. 

    Thanks for a fun discussion.

    You don´t understand what the word “discussion” means. 
    It means “Consideration of a subject by a group; an earnest conversation”.
    You don´t consider anything we have to say and you show no sincerity or seriousness whatsoever – all you are interested in doing is lying, trolling and generally being an asshole.   

    Besides, it’s clear from your own inconsistency, that you don’t really mean the things you say.

    No, I actually mean that you are a pathetic, deplorable, lying scumbag. 
    If you actually consider yourself to be a christian (I´m really not that sure, Poe seems to be just as likely), you are a pathetic witness for Christ. 
    You like to talk about “repenting” and “turning away from your sins”, just yesterday you claimed that people who deconverted “loved some sin and didn’t want to give it up”.
    Yet, I´ve rarely seen an example of a person who so consistently, so often, so obviously and so casually lies like you. You don´t only disregard biblical commandments about honesty, you vomit on them. 
    You seem to earnestly believe the stupidest stories in the Bible – Eden, Noah, Babel etc. But when it talks about being honest, helping the poor, not being judgmental etc. – you literally could not care less about it.

    If there would be more christians like this guy or this gal – we might think that Christianity might be a collection of silly myths, but it apparently promotes compassion, honesty and courage for many people. 
    But the more we see notorious liars like this guy or this guy or you – it also becomes more and more obvious that religion in general, and christianity in particular really does poison everything. 

    If you want to promote the cause of christianity – hide under a rock and leave the outreach part to your brothers and sisters that can behave like decent human beings. 

  • JohnM

    First I’m a dishonest scum-bag.. Then I’m a retard. Then I’m a troll.

    If I were a dishonest scum-bag, I wouldn’t be a retard. And if I were a retard, I wouldn’t have the mental capacity to manipulate and troll you.

    Clearly, you don’t know what leg to stand on. It’s like you only have this simple toolbox of a hammer, a saw and a screwdriver. First you try one, then the other, then the third, and if nothing works, you turn back to the first tool, hoping that it’ll work this time. It’s really not that impressive, Andy.

    As for lying..  You’re the obviously liar, when you proclaim me to be mentally retarded. Anyone with one eye, and half a brain, can tell that I’m not. And you know perfectly well, that I’m not mentally retarded.  

    Besides that, you’re the guy who made a typo and wrote “retarted ”… so maybe you should try the only strategy that you haven’t tried yet, in this thread..  Correcting my typos and calling me an idiot. And good luck with that.

  • Andy_Schueler

    First I’m a dishonest scum-bag.. Then I’m a retard. Then I’m a troll.

    Yes, you are dishonest, mentally deficient and a troll. Which has by now been exhaustively documented.

    Anyone with one eye, and half a brain, can tell that I’m not. And you know perfectly well, that I’m not mentally retarded.  

    Oh you certainly are mentally deficient, but it is sometimes hard to tell whether you are just trolling like here:
    http://www.skepticink.com/tippling/2013/02/15/endogenous-retroviruses-as-evidence-for-evolution/#comment-803452829
    or being genuinely confused due to your lack of intelligence like here: 
    http://www.skepticink.com/tippling/2013/02/15/endogenous-retroviruses-as-evidence-for-evolution/#comment-803310345

  • Andy_Schueler

    First I’m a dishonest scum-bag.. Then I’m a retard. Then I’m a troll.

    Yes, you are mentally deficient, a notorious liar and a troll.

    If I were a dishonest scum-bag, I wouldn’t be a retard.

    Non sequitur. Being mentally deficient does not mean that you cannot be a liar and act like a complete ass, case in point – you.

    And if I were a retard, I wouldn’t have the mental capacity to manipulate and troll you.

    Your argument being that trolls cannot be idiots. Non sequitur – you would need at least average intelligence to be funny or creative troll, but not for being a run-of-the-mill troll. 

    Anyone with one eye, and half a brain, can tell that I’m not. And you know perfectly well, that I’m not mentally retarded.  

    Oh you certainly are mentally deficient. But it is sometimes hard to tell whether you are just lying / trolling like here:
    http://www.skepticink.com/tippling/2013/02/15/endogenous-retroviruses-as-evidence-for-evolution/#comment-803452829
    or being genuinely confused due to your lack of intelligence like here:
    http://www.skepticink.com/tippling/2013/02/15/endogenous-retroviruses-as-evidence-for-evolution/#comment-803310345

  • Andy_Schueler

    Btw, if you want to argue that you are not a troll and not an idiot, then complete these sentences:
    “I´m not a troll, but I still wrote this comment:

    Yeah. Like monkeys typing randomly without a head monkey designer. Or someone spilling ink on a white paper, that happens to arrange itself in such a way, that it precisely match today’s newspaper.

    Three word for you: Blind Irrational Faith.

    because [...]”

    “I´m not an idiot, but I still wrote this comment:

    Lol! What the… Crystals?!

    What does that have to do with DNA?

    Nothing. You just posted a whole lot of nothing.

    because [...]“

  • Pingback: IDist commenter bets my co-writer $10,000. And loses. What to do?! | A Tippling Philosopher