Pages Menu
TwitterRssFacebook
Categories Menu

Posted by on Oct 30, 2012 in Evolution | 207 comments

The Predictive Power of Evolution

I have been reading the first chapter of Neil Shubin’s Your Inner Fish recently and it really struck me again how strong, persuasive  nay indomitable, the predictive powers of evolution are. The simple idea that a paleontologist can think that the first fish fossils were found  at time A and the first limbed land animal fossils were found at time C, and so to find the transitional fossils for animals in between fish and limbed land animals should be found at time B (in this case, the late Devonian period). But this is already dependent upon the prediction that the fish should transform over time to limbed land animals.

Not only this, but the prediction was that such fossils be found in sedimentary rock at river deltas much like the present day Amazon. The time, place and type of fossil are entirely predicted by the evolutionary fossil. So after searching several such places, what do they find? Tiktaalik, the transitional fossil that they predicted they would find.

Now, to evolutionists (I don’t like that term because it implies one can just choose to believe in evolution like choosing to be a Democrat or Republican), this is all horrendously obvious. But the power, as a theory, of predictive capabilities comes when comparing it to alternative theories. Any young earth, intelligent design type theory has NO predictive power. ABSOLUTELY NONE. And this is because they are incredibly ad hoc.

Another startling aspect of evolution which coheres perfectly is the anatomical blueprint set out by organisms. We can predict what we might find further back in the evolutionary lines based on present anatomy and, if possible, earlier anatomy. Take the hands and arms, for example. See the attached pictures. It is not as if, suddenly, an animal goes from 2 fingers to eight, or vice versa. Everything is connected in a transitional process, and everything uses the same basic plan. Tiktaalik (or an earlier unknown version) started the move towards the wrist, and fingers. From this branch we can map out how hands and arms and even hooves evolved. And we can predict missing gaps. The whole map makes sense.

What can we predict, anatomically, on a young earth / ID thesis? Well, absolutely nothing. In fact, given the notion of an intelligent designer, we might predict even better design than the animals which exist or have existed. Evolution often only guarantees adequate design to allow the organism to survive and reproduce. There are aspects of every animal, including humans, which could be better designed.

So because evolution makes sense from start to finish and fits in with ALL disciplines of science, it has incredible predictive powers. It amazes me that people can even begin to doubt it.

 

 

  • Andy_Schueler

    Any young earth, intelligent design type theory has NO predictive power. ABSOLUTELY NONE. And this is because they are incredibly ad hoc.

    I´m not sure – YEC seems to make plenty of predictions for Biology and Geology, they have just all been falsified. When you shift from a creation model based on a literal reading of Genesis to a “model” involving an unknown number of unknown designers of unknown nature with unknown abilities and unknown motivations, then you loose all predictive power because there is no conceivable observation that could support or contradict such an idea. So, in a sense, YEC could have been a valid scientific approach (if it would not have been refuted) while ID is a failure by design (pun intended) .

  • SmilodonsRetreat

    I agree with Andy.  Even ID has made a few predictions… sort of… and they’ve all been refuted.  Of course, most where also statements of negative. 

    Just wait until you get into the later chapters.  Talk about some good stuff in there!

    I’ll just throw in on the ALL areas of science.  Geology provides supporting evidence for evolution and can be predicted by evolution.  Geography provides supporting evidence for evolution and can be predicted by evolution.  Math, chemistry, and physics all provide supporting evidence for evolution and can be predicted by evolution.

    And by “predicted ” I mean that evolution provides data that can be used to predict certain features that would normally be in the realm of chemistry or geology.  For example, if you find a Pakicetus fossil, then you make certain predictions about the environment… and thus the geology and geography of the area.  If you, instead, find a  Basilosaurus fossil, that tells you something very different about the area.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    ID predictions are not *real* predictions. Saying that ID predicts “complexity” tells us absolutely nothing. Darwin predicted, based on homologies with African apes, that human ancestors arose in Africa. That prediction has been supported by fossil and genetic evidence. Now that is a prediction. Evolutionary Theory predicted that organisms in heterogeneous and rapidly changing environments should have higher mutation rates. This has been found in the case of bacteria infecting the lungs of chronic cystic fibrosis patients. Ernst Mayr predicted in 1954 that speciation should be accompanied with faster genetic evolution. A phylogenetic analysis has supported this prediction.

    It was predicted that insect wings evolved from gills, with an intermediate stage of skimming on the water surface. Since the primitive surface-skimming condition is widespread among stoneflies, J. H. Marden predicted that stoneflies would likely retain other primitive traits, too. This prediction led to the discovery in stoneflies of functional hemocyanin, used for oxygen transport in other arthropods but never before found in insects. Darwin predicted that precursors to the trilobite would be found in pre-Silurian rocks. He was correct: they were subsequently found.

    Evolutions predictions can go on all day long.
     

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    I agree with you John. 

    I don’t think ID can make predictions, any more than I predict the moon is made of cheese. The entire enterprise is ad hoc.

    By predictions, I mean, of course, predictions that work. So the predictions that YEC make are falsified; and then they change the goal posts. I do not see these as qualifying as predictions. Evolution predicts things, and we find them to be true. ID does not do this.

  • SmilodonsRetreat

    I think I disagree, but only in a matter of a tiny little bit. 

    I don’t think ID can make predictions, any more than I predict the moon is made of cheese. The entire enterprise is ad hoc.

    By predictions, I mean, of course, predictions that work.

    You can predict the moon is made of green cheese.  That’s a perfectly valid prediction.  Of course, that prediction has been falsified.

    I’m not entirely sure what you mean by “predictions that work”.  I don’t think you mean predictions that turn out to be true.  If you only predict things you know to be true, then you aren’t really predicting.

    ID has made negative predictions (i.e. evolution can’t do ‘x’) and almost universally those have been proven to be wrong. 

    Now, what I think you mean is valid predictions based on evidence and evidence.  So not “the moon is made of green cheese”, but “the moon’s dust is so thick spacecraft will get stuck if they try to land there.”  Both are false, but one of them has some actual thought and science behind it.

    ID is a dead horse, no two ways about it.  We’re just waiting for the thing to stop stinking up the entire barn.  However, it’s still good talk about because the anti-vaxxers, global warming deniers, and anti-GMO groups are all using the exact same tactics learned from the creationists.

  • JohnM

    I’m pretty sure, that you would be able to find the same kind of “anatomical” similarities in much of the computer code that I’ve worked on in my life.

    It’s rather rare for computer-programmers to write something from the bottom up. Nobody starts from scratch. It’s too expensive, time wise. We tend to have a “Starter kit” or take existing code / modules / thing we have worked in the past, and just modify / re-engineer them for the purpose.

    So I’m not surprised to see anatomically patters in animals. That exactly what one would expect, if it was the result of design.. In programming we even refer to such things as “design patterns”.

    http://en.wikipedia.org/wiki/Software_design_pattern

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    I guess what I mean is this:

    1) Evolution provides a massive framework which interconnects with other disciplines
    2) Within this framework certain things are missing, but it follows necessarily what should be in those gaps
    3) The framework itself provides the predictions for the gaps (without wanting to give evolution human agency)

    On the other hand,

    1) ID or YEC don’t provide a viable framework which interconnect with other dicsiplines
    2) There aren’t really any gaps because the whole enterprise is ad hoc

    YEC is difficult because there is the whole issue of burying empirical evidence and ignoring known consensus discipline conclusions. As such, it is rather ostrich-like. 

    For example, which theories predict what type of fossils might exist in Australia which date to x million years old?

    Which theories predict that there must be units of heritability (ie genes)?

    And so on.

    I love your connection to the other denial camps.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    “Nobody starts from scratch. It’s too expensive, time wise. We tend to have a “Starter kit” or take existing code / modules / thing we have worked in the past, and just modify / re-engineer them for the purpose.”

    Are you analogising this to God’s design? Only that efficiency and wasting time are not relevant to God whatsoever. Thus, false analogy.

  • JohnM

    The only reason that any designer / programmer would start from scratch, is if the first attempt turned out to be a horrible failure. Good design / good code, is intended to be reused. And one would be a fool, if one did not.

  • SmilodonsRetreat

    Jon, yes, we’re saying the same thing.  I think I just have a slightly different opinion on the nature of prediction.  All your points are totally correct.

    ID isn’t science.  It’s a Christian political/social movement to somehow/anyhow get religion back into the classroom.

    JohnM,
    Computer code that you write doesn’t self reproduce.  Therefore non-analogous to biology.
    Computer code that does self-reproduce follows the established principles of evolution… every single time.

    But, let’s talk about this a second.  You say that ID predicts that organisms share common features, slightly modified.  We say that evolution predicts that organisms share common features, slightly modified. 

    So, what’s the difference between ID and evolution?  According to you (and other creationists I’ve talked with), there isn’t any… except for the existence of the designer.  But since ID expressly denies the search for the existence of the designer AND the tools of the designer AND any other thing that would allow us to discriminate between ID and evolution… what’s the point?

    We know, for a fact, that evolution works.  There are thousands of products, systems, and processes that are direct results of knowledge of evolutionary principles.  These things range from medicine to factory scheduling.

    There are no products, systems, or processes that use the principles of Intelligent Design (in terms of biology, we’re not talking about intelligent design of a product).  Heck, there aren’t even any principles of Intelligent Design.

    Intelligent Design is 100% about making stuff up that sounds sciency and will full the people who don’t have a decent education into thinking there’s something to it.  There’s not.

    But if you want to play, then let’s play (with Jonathan’s permission).  On average, it takes me about 8 posts (each) to find that the ID proponent has contradicted himself.  Depending on the person, they sometimes do it within the same post.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    permission definitely granted.

  • JohnM

     SmilodonsRetreat:

    Therefore non-analogous to biology.

    ORLY?!

    TTGGCGTAATCATGGTCATAGCTGTTT

    01000101010101010101010101010101010

    Get it?

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    Read “Scientists Confront Creationism: Intelligent Design and Beyond” by Laurie R. Godfrey and Andrew J. Petto which will give you detailed reasons why from top scientists that Intelligent Design is not science. ID has absolutely nothing but vague ambiguity posing as science when it is not, when in fact evolution has robust explanatory power and real predictability.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    BTW, computer code was built from a bottom up approach not a top down one.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    An interesting article “Is Intelligent Design Falsifiable”

    http://theness.com/neurologicablog/index.php/is-intelligent-design-falsifiable/

  • JohnM

    Jonathan:

    In fact, given the notion of an intelligent designer, we might predict even better design than the animals which exist or have existed. Evolution often only guarantees adequate design to allow the organism to survive and reproduce. There are aspects of every animal, including humans, which could be better designed.

    That’s a flawed objection..  A cornerstone in design, is: Form follows function.

    One cannot criticise “Use and throw away” products, for not being durable enough. That’s completely missing the point, as it is not the purpose of the product.

    And so one has to ask.. What were humans actually designed to do?

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Brilliant.

    “A cornerstone in design, is: Form follows function.”

    So all I have to do is show you an example of a shit form following function to disprove your God designer thesis?

    This will be too easy.

  • JohnM

    Shit form of what function?

    First you make a really good quality light-ball. It has 20.000h life.. Great product for the customers. But now you’re not selling any light balls, as they all last too long, and nobody needs to buy any new ones. So was that a great design, looking at your sales figures?

    If the goal of the design, was to give the customers a long life lightball, then yes.

    If the goal was to make money, then the answer is no.

    Form follows function. Good design is relative to the goal of the design.

    You have to determine the goal, the designer had in mind, to actually judge the design.

  • NoCrossNoCrescent

    The absurdity of creationist claims is mind numbing. Once I asked one of them if kangaroos and other marsupials trekked all the way from Turkey (afrer the “flood”) to Australia, where are all the extant and living marsupials linking the two? His answer: “it is a problem for both creation and evolution”. Yeah, deflect criticism when you can’t do any better.

  • NoCrossNoCrescent

    Form follows function.
    Except when it doesn’t…
    For example, naked mole rats have eyes that don’t see. They don’t need eyes because they live in total darkness. So what is the point in having organs that don’t work?
    They evolved from ancestors that had functioning eyes. But once their lifestyle changed, they had no more use for the eyes and they lost their function.
    The “point” of having vestigial organs, if any, is to make us realize that evolution happened.

  • NoCrossNoCrescent

    But only a stupid designer would apply the same design to a plane and a submarine, don’t you think? Or, say, a whale and bat?

  • Richard Edwards

    JohnM: “You have to determine the goal, the designer had in mind, to actually judge the design.”

    This is exactly what people mean when they say that ID has no explanatory/predictive power. Without this information it is all post hoc rationalisation and we can never have/test this information. Evolution by Natural Selection (and genetic drift) posits clear functions (and fitness) that can (in principle) be tested.

    Please explain, for example, the design feature of the mammalian inverted retina. Did the Designer want us to have a blind spot? (Is that where (s)he/it hides, perhaps?)

  • JohnM

    But only a stupid designer would apply the same design to a plane and a submarine, don’t you think?

    Wouldn’t that depend on, what the purpose of the design was?

  • NoCrossNoCrescent

    Sure. If the designer wants everyone to think he can’t do any better than to remodel a tank so it does the function of a plane. To look incompetent, is that the “purpose” of your designer? Or perhaps he is trying to tell us we don’t need him to explain how living things came to be.

  • NoCrossNoCrescent

    Hm. Then why is an eye without a blind spot “good design” for squids but not humans?

  • JohnM

    Richard Edwards :

    Please explain, for example, the design feature of the mammalian inverted retina. Did the Designer want us to have a blind spot?

    First off all, I don’t claim to have all the answers. But it is pretty easy to come up with possible explanations for even things you would call “bad design”. Predators gotta eat too, right?

    The possibilities of “ad hoc” explanations are endless. And it’s actually more or less impossible, to point at something, and say “that’s bad design”, without knowing the goal of the design.

  • JohnM

     NoCrossNoCrescent :

    If the designer wants everyone to think he can’t do any better than to remodel a tank so it does the function of a plane.

    A flying tank? Brilliant. Where can we get one?

    NoCrossNoCrescent :

    Hm. Then why is an eye without a blind spot “good design” for squids but not humans?

    Well you would have to ask the designer. But I’m sure the possibilities are endless.

  • Richard Edwards

    Thank you for confirming the uselessness and lack of any predictive power of the Designer hypothesis. I will stick to evolutionary theory, which, in total contrast, is both predictive and useful.

    BTW, while “ad hoc” explanations might be endless, they are not endlessly sensible nor endlessly convincing. When given a choice between the slightly comical (if not so disturbing) “deliberate design flaws” hypothesis and the clearly demonstrated evolutionary history plus developmental contraint hypothesis, I know which one makes more sense. The fact remains that adherents to Designer hypotheses of various kinds only do so because they have made an a priori decision that there was a designer and refuse to accept more parsimonious explanations that reject this assumption. (Hence the criticism of being unscientific.)

  • Richard Edwards

    @johnnyp76:disqus , can I suggest that you alter your post title to “The Predictive Power of Evolution”, rather than “The Predictability of Evolution”? Following your recent post on whether adaptation can be predicted into the future, I think there is some possibility for confusion here. As you point out, the predictive power of evolution has been tested and demonstrated countless times in the last two hundred years. Exactly when and where the trajectory of evolution can predicted into the future is still an open question.

  • JohnM

     Richard Edwards:

    I will stick to evolutionary theory

    Well it’s a free country…

    But think about how ridiculous it is, to talk about “bad design”.. Say for example, that we have a Cheetah. It can run down a Gazelle. The Gazelle dies.. So it must be bad design right? But what if it was faster? Then the Cheetah would starve to death, and then it would be bad design.

    You have to look at things from a bigger perspective. The whole issue is a bit more complex than “some animals have blind spots and therefore must be bad design”.

  • NoCrossNoCrescent

    Good thing when you don’t have an answer you can plead ignorance. But we precisely don’t have flying tanks because no designer with foresight, unlike yours, would try to make one.

  • NoCrossNoCrescent

    So why only one designer? Shouldn’t we believe in as many designers as there are living things? Sure the fact that a Honda and a Ford have similarities doesn’t mean same person made them?

  • JohnM

    Actually, there’s been flying tanks since the 2nd world war.. They call em B-17′s

  • Richard Edwards

    But it’s not design at all! That’s the point. I agree – talking about “bad design” is ridiculous unless you invoke a Designer… but why invoke a Designer in the first place? There’s no need for one. It doesn’t explain anything. As you have so clearly demonstrated, it makes it harder (maybe impossible?) to have an explanation for anything.

    I also think you have a very naive view of what we mean by “if there was a Designer then this would be bad design”. Everything is a trade-off, so it is not surprising to see cheetahs and gazelles that cannot run infinitely fast. Bad design is sharing a genetic code with close relatives, so you can catch their viruses (e.g. HIV, swine flu, bird flu etc.) and die… unless we are designed to get ill. Bad design is an eye wired back-to-front. It’s certainly not the most obvious way to make one vulnerable to predators. Bad design is a nerve that loops all the way down and back up a giraffe’s neck for no apparent reason. Ad hoc explanations for these observations go from sublime to ridiculous and all are 100% unnecessary because *there is no design*.

    The only bigger perspective for a Design advocate is either (a) the Designer is a bit crap, or (b) the Designer is a bit twisted. The Designer is certainly inconsistent. Or, if you want a bigger picture that is consistent with ALL the data… there is no Designer.

    But, yes, free country. I just won’t hold my breath waiting for ID to figure out the functions of any proteins, or causes of disease, or possible drug side effects using “Design theory”.

  • frisbee_kid

    1- Tiktaalik was not a prediction of natural selection

    2- Tetrapods existed before Tiktaalik- that means we have fish fossils, tetrapods, then Tiktaalik, the fish-a-pod. Oops, that is out of order.

    3- Intelligent Design is not anti-evolution- Kevin will argue that it is but that is because he conflates evolution, the thing, with the theory of evolution, the explanation of the thing. He also sez that the theory of evolution is not the blind watchmaker thesis yet the only way ID is anti-evolution is if you define evolution as the blind watchmaker thesis.

    4- Linnean taxonomy was based on a common design

  • NoCrossNoCrescent

    You don’t get it, do you.
    Of course a blind spot is a bad thing. But the question here is PATTERNS.
    All vertebrates have eyes with blind spots. Cephalopods have eyes without blind spots. This indicates SHARED ANCESTRY. If you could find one chordate without blind spots or one cephalopod with blind spots, that would destroy evolutionary biology. So is your god trying to trick us into thinking evolution is real, or what?

  • NoCrossNoCrescent

    1. Wrong. Transitional forms are a prediction of evolutionary theory.
    2. Mind naming one? There were tetrapods at about the same time as tiktaalik, but that’s because evolution is a tree, not a ladder.
    3. ID is anti-science as it denies understood mechanisms and replace them with superstition.
    4. Linnaeus can be forgiven for not knowing about Darwinian science because of when he was born. Modern creationism doesn’t havw that excuse.

  • frisbee_kid

    Kevin,

    Nice to see that you are still equivocating- guys ID is not anti-evolution.

    ID is OK with mutations. ID says that most are directed, ie not left to chance.

    ID is OK with mutations accumulating and bringing about changes. Again, the changes would be directed, part of the plan.

    The evolutionary principles used in any industry are Intelligent Design priinciples- all targeted searches- all for a goal. That’s ID. That is NOT the blind watchmaker.

    Also Kevin is wrong, again, as usual, as ID does NOT deny the search for the designer nor the methods- they are separate questions, Kevin. We do NOT need to know who and how BEFORE determining design.

  • NoCrossNoCrescent

    Nope. At no stage in their making they look like tanks. Unlike human beings and fish

  • NoCrossNoCrescent

    Denying established mechanisms in science IS being anti-science.
    Beneficial mutations do not happen together. If you could show something like that you’d win the Nobel prize. What does happen is a mix of good,bad, and neutral. But good onesand accumulate because they are favored by natural selection.

  • SmilodonsRetreat

    First point: This discussion is biology.  Biology is fundamentally different from aircraft, tanks, light bulbs, factories, computers, and computer programs.  Living things reproduce imperfectly.  Nothing else designed or not does not.  Don’t get bogged down in stupid analogies like computer programs.  They are analogies only and poor ones. 

    These analogies exist, because ID proponents are generally incapable of actually talking about the biology and chemistry involved in living systems.

    The single exception is evolutionary algorithms.  Which are, guess what, evolution in action.  Yes, the programs are designed.  They are designed by humans to mimic how evolution works.  That is, imperfect reproduction of a system. They produce products and processes that it is impossible for humans to understand.  So the results, are NOT designed, but evolved.

    There’s a fascinating article about Field Programmable Gate Arrays (FPGAs) where a system evolved the ability to recognize the words “stop” and “go” when spoken into a microphone.  However, to date (as far as I know), no one understands how the circuit works.  There is no clock, which is the first thing a human engineer puts in such a device.  There is a complete secondary circuit not even connected to the primary circuit.  No one has a clue what it does, but if that secondary circuit is disconnected, the primary circuit can no longer recognize “stop” and “go”.

    This isn’t design… it’s evolution.

    The one thing that no ID proponent can ever deal with is that evolution simply works.  JoeG (AKA frisbee_kid) can’t name a single process, system, or product that is the result of the “science” of Intelligent Design.  Neither can anyone else.  I can name dozens right off the top of my head for evolutionary principles. 

    As far as the rest Joe, you have been owned on all of that stuff for a long time.  You still cry about the same thing over and over.  Let’s go back to our debate on whether ID was anti-evolution.  I used quotes from the people who invented Intelligent Design who stated that ID is a competitor hypothesis to ID.  Heck, you yourself, JoeG, have stated that all we have to do to disprove ID is to prove evolution.  By your own words, ID is anti-evolution. 

    I will not talk about this with you further.

    JohnM, you make this curious claim

    ORLY?!

    TTGGCGTAATCATGGTCATAGCTGTTT

    01000101010101010101010101010101010

    Get it?

    Fine, so 01000101010101010101010101010 is information storage, right?  Is that also a catalyst for processing of materials? In other words, in the software you write, is the code also the data that it acts on?  Because it is in DNA.

    Show me how computer code reproduces imperfectly in the software you write.  Does it require a different bit of code or does it copy itself?  What’s the level of redundancy in your computer code?  I.e. how much of a change is required to the code before an actual change results in the program (genotype vs. phenotype)? 

    Please point to one IF/THEN statement in your DNA (or any DNA).  Show me a library of objects in DNA.  What is the compiler of the DNA?Do you get it?  DNA IS NOT COMPUTER CODE.  It’s not even close.
    Now, let’s actually talk about Intelligent Design.  Are you two (JoeG and JohnM) willing to put up or shut up?  Are willing to try to do the one thing that ID proponents must be able to do?  I know Joe isn’t.  He’s been avoiding this for almost two years now.

    So, here it is.  I will provide you with two strings of DNA.  One will be from a living organism, the other will be a random string generated using random.org.  I want you to use the principles of Intelligent Design to tell me which is which.  Show me how to calculate, measure, or determine the answer. I will then ask you to generate a random string and a designed string that I will use the principles and processes that you have taught me to determine which is designed and which is not.  If I can’t, then ID is junk.Now Joe doesn’t like that challenge.  For some reason he thinks that the ability to determine the difference between a designed thing and a non-designed thing isn’t important to ID.  There are several people at Uncommon Descent who disagree with him, but curiously, he avoids mentioning that to them.

    So I have a different challenge for Joe and JohnM as well.  This one is strictly to with the information content of two strands of DNA.  I will provide them at either request… I’ll probably put them on SmilodonsRetreat because they are fairly large.  Both DNA strings come from living humans.  In fact both can be in the same human at the same time.  In fact, there is a one nucleotide difference between them, yet their function is slightly different.  One provides a greater survival advantage in one environment while the other provides a different survival advantage in another environment.The question is simply, “which has more information?”Joe’s been ducking this one for at least 6 months now.  Either challenge boys.  Let’s see Intelligent Design in action.

  • frisbee_kid

    Kevin,

    Your position cannot explain reproduction, so can it already. If your position could explain it then we wouldn’t be having any debate about biology.

    Evolutionary algorithms are a design mechanism- they are designed to solve problems. It is evolution by design, ie designed to evolve- Intelligent Design.

    And Kevin your quotes say that ID is anti-DARWINIAN evolution- just as I have said. As my post proves, all the ID leaders say ID is OK with “evolution”. So get a life already. 

    And no Kevin, you are lying again as I never said that to falsify ID you have to prove “evolution”. I said that to falsift ID all you have to do is demonstrate that blind and undirected processes, like natural selection and genetic drift wrt biology, can produce it.

    And your “challenge” is a strawman. The point of ID is to determine if an agency was involved in some way.

    Finally, Tiktaalik was found to be out-of-order in order for it to be used as the prediction stated in the OP.

  • frisbee_kid

    BTW Kevin, the ribosome is a genetic compiler, think about it, if you can.

    So, here it is. I will provide you with two strings of DNA. One will be from a living organism, the other will be a random string generated using random.org.

    That has nothing to do with anything ID claims, Kevin.

    Ya see SCIENCE is all about making observations in the REAL WORLD and then trying to explain them.

    BTW forensic science claims to be able to tell design from not. So by your “logic” forensic science is useless if a forensic scientist cannot answer your challenge. Archeaologists claim to be able to determine design from not also. Geez Kevin, you are blowing away valid fields of science with one strawman!

  • frisbee_kid

    For some reason he thinks that the ability to determine the difference between a designed thing and a non-designed thing isn’t important to ID. 

    No, that is VERY important. OTOH your strawman isn’t important.

    Tell you what. Instead of random.org generating a DNA sequence, just put a bunch of nucleotides in a flask and see what forms. Then post the sequence and put that up against the human sequence.

    Be sure to save the speciman so we can confirm your work. Thanks

  • NoCrossNoCrescent

    It is nice that you keep repeating claims and think that makes them true.
    Tiktaaalik, as much as you hate it, is a transitional form. Evolution predicts exactly in what age of rock you should find fish becoming land tetrapods. Neil Shubin went to the arctic because he knew precisely where to look.
    We know that random mutations followed by natural selection can lead to new species. Since that is the only mechanism we have observed, we have no reason to think that anything else is involved in the process. If you want to add a designer to the system you have to show a mechanism hiw rhe deaigner works. You have failed to do so.

  • NoCrossNoCrescent

    Eh…the experiment doesn’t count because there is no natural selection.

  • NoCrossNoCrescent

    When you look at cancer does it look designed to you? It has the exact mutations it needs to escape body regulations, grow blood vessels, invade and metastasize.

  • SmilodonsRetreat

    Joe, you keep saying the same things over and over.  You’ve said them for well over two years. It still doesn’t make it true.

    But let’s look…

    Your position cannot explain reproduction, so can it already. If your
    position could explain it then we wouldn’t be having any debate about
    biology.

    umm… do you even understand what I’ve written above?  Evolution is ALL about reproduction.  That’s the whole bloody point.  You think we can’t explain it?  Oh wait… self replicating RNAs
    http://www.newscientist.com/blogs/shortsharpscience/2011/04/rna-enzyme-makes-another-rna-e.html

    http://www.sciencedaily.com/releases/2009/01/090109173205.htm

    http://www.sciencemag.org/content/323/5918/1229.abstract

    http://www.livescience.com/3214-life-created-lab.html

    Evolutionary algorithms are a design mechanism- they are designed to
    solve problems. It is evolution by design, ie designed to evolve-
    Intelligent Design.

    Exactly.  The programs are designed.  The result aren’t.  but I’ve said this to you a dozen times already.

    If the results were designed, then engineers who design roulette wheels would be billionaires.

    And Kevin your quotes say that ID is anti-DARWINIAN evolution- just
    as I have said. As my post proves, all the ID leaders say ID is OK with
    “evolution”. So get a life already.

    Which just goes to show that the leaders of ID will say ANYTHING if they think it will get them what they want.  Which is, according to their own internal mission plan, nothing less than the incorporation of modern Christianity in every aspect of our lives.

    http://www.antievolution.org/features/wedge.html

    And no Kevin, you are lying again as I never said that to falsify ID
    you have to prove “evolution”. I said that to falsift ID all you have to
    do is demonstrate that blind and undirected processes, like natural
    selection and genetic drift wrt biology, can produce it.

    Oh yes, of course, that’s what you said.  Oh well then, it’s a good thing that no living or past scientist or person who studies biology thinks that evolution is only “blind and undirected processes”.  For the billionth time… there’s this thing called selection.  No matter how many times you quotemine someone else or declare the “natural selection is a result, not a process”, it doesn’t make it true.

    And your “challenge” is a strawman. The point of ID is to determine if an agency was involved in some way.

    Yes, Joe, the challenge is exactly that to determine if an INTELLIGENT agency was involved in someway.  The opposite of an intelligent agent would be 100% random.  Therefore, the challenge would actually help you, but you don’t know enough about science to understand that.Besides, if you can’t tell the difference between 100% random and 100% designed, then how can you possibly expect to tell the difference between evolved and designed.Besides (2), aren’t you the one who keeps saying that I think “blind and undirected processes” are all that it takes?  {checks notes} Yes, that is you saying that Joe.  (It’s not me saying it, it’s that Joe thinks that it is what I think.  He’s wrong, but then he’s wrong about so so many things.)

    So, there you go Joe.  If you want to to utterly defeat what you think my position is, then this challenge is perfect for you.You won’t accept it though. Because deep down you know all the mathy stuff in ID is 100% BS.  I’ve told you a dozen times, I sit next to no fewer than 8 mathematicians, most of whom have graduate degrees.  I can pick up the phone and call no less than 4 people with PhDs in statistics and statistical analysis.  Don’t let your opinion of my math skills stop you.  I can take it.

    But I’ve been telling you that for at least a year.  Still nothing.

    Finally, Tiktaalik was found to be out-of-order in order for it to be used as the prediction stated in the OP.

    Sorry Joe…. again… look up “transitional fossil”… no statment of TIME in the definition.  Only character.  But we’ve been over this ten or twelve times too.

  • Andy_Schueler

    2- Tetrapods existed before Tiktaalik- that means we have fish fossils, tetrapods, then Tiktaalik, the fish-a-pod. Oops, that is out of order.

    I already explained it to you several times, Tiktaalik is no ancestor of tetrapods and no one ever claimed it would be one. Also, no one expected to find one, this would be exceedingly improbable because:
    1. Fossilization is an extremely rare event.
    2. Most lineages die out.
    These two facts mean that most fossils of organisms that lived millions of years ago have no living descendants, they are not ancestral to any living organism, they  are sister groups (i.e. cousins). 
    And a close sister group was exactly what Shubin was looking for, it was not as close as they expected in 2006, but still very close, and it shows exactly the distribution of morphological features that Shubin´s group expected. 
    This really is Paleontology 101 stuff…

  • Andy_Schueler

    ID is OK with mutations accumulating and bringing about changes. Again, the changes would be directed, part of the plan.

    That would be anti-evolution because it contradicts a key tenet of evolutionary theory. Mutations are random wrt fitness. This is a well documented fact and no one so far was able to show any evidence to the contrary.

  • SmilodonsRetreat

    Tell you what. Instead of random.org
    generating a DNA sequence, just put a bunch of nucleotides in a flask
    and see what forms. Then post the sequence and put that up against the
    human sequence.

    Yes, that’s an excellent idea.  Let’s put a bunch of nucleotides in a flask and see what forms.  You know what forms Joe?

    RNA-based enzymes. 
    100 base strands of RNA
    Thousands, millions, billions of them.  Until one forms that can catalyze the reproduction of another one… or itself.

    Joe, I’ve been posting papers that have been doing this for over two years now.  Haven’t you read them?

    Oh, you still want RNA that turns into human RNA.  Sorry, you’re the only person who thinks that’s a requirement.  And Joe, you don’t count.

    To all… every single statement made here by JoeG/frisbee_kid is the exact same statement that he has made before.  It never changes.  Here’s a link to his thread on AtBC, you’ll see these exact same arguments in 2010.  http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=5090472635dfdf17;act=ST;f=14;t=6647

    I’m done with JoeG/frisbee_kid.

    JohnM, if you have any questions, I’ll be happy to answer them.  But I’m not wasting more time, energy, and bandwidth telling Joe for the ten thousandth time what he refused to learn about the thousandth time.

  • Andy_Schueler

    Tell you what. Instead of random.org generating a DNA sequence, just put a bunch of nucleotides in a flask and see what forms. Then post the sequence and put that up against the human sequence.

    You´ll find biologically meaningful functions in a completely random cDNA library (e.g. ATP binding functionality). If ID research can produce a method to distinguish DNA sequences based on their origin (random sequences, evolved sequences, designed sequences and sequences that were produced by rational design + artificial selection) we would take you guys seriously (and you could earn several nobel prizes and sign million dollar contracts with the army to develop counter-bioterrorism measures…).  

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    “But think about how ridiculous it is, to talk about “bad design”.. Say for example, that we have a Cheetah. It can run down a Gazelle. The Gazelle dies.. So it must be bad design right? But what if it was faster? Then the Cheetah would starve to death, and then it would be bad design.”

    This is the arms race process of evolution. It’s why the top fastest animals on earth are made up of both predators and prey. This paragraph actually supports evolution. Though you would know that if you knew your evolution well enough!

  • The whole truth

    joe g/frisbee_kid said:

    “And Kevin your quotes say that ID is anti-DARWINIAN evolution- just as I have said. As my post proves, all the ID leaders say ID is OK with “evolution”. So get a life already. ”

    You’re trying to get away with one of your usual tricks there joey. In your statement above you completely rely on what, according to you, “all the ID leaders say” and you expect others to do the same but when it’s pointed out to you (and it has been many times) that the so-called “ID leaders” say things that are massively contradictory, or are totally against evolution of any type, or are nothing but the preaching and propaganda of a religious/political agenda, or are dishonest, or are strawmen, red herrings, ad hominems,  etc., or are already refuted, or are just plain stupid, you completely rely on what “ID” allegedly says, not on what “all the ID leaders say”. In other words, when it suits you you conveniently separate “ID” from what “all the ID leaders say” and/or from what any of the so-called “ID leaders” say.  

    So, joey, should you and everyone else rely on what “ID” says (whatever that is at the time) or on what “all the ID leaders say” (whatever that is at the time) or on what certain “ID leaders” say at certain times or what? 

    And will you list “all the ID leaders” by name, and provide links to where they have all said that they’re OK with evolution? 

  • Richard Edwards

    JoeG, I too have had this dance with you before, so will limit myself to one response.

    Your tired old analogy with evolutionary algorithms contradicts your own position! It is an analogy of “Theistic Evolution” – a Creator kicks things off and then watches the show. The products are NOT designed. They are EVOLVED. The ALGORITHM is the bit that is designed. You claim that undirected mutations are the downfall of evolutionary theory (despite the mountains of evidence demonstrating that mutations are NOT directed with respect to their effects – random does not equal uniform -) and yet in an evolutionary algorithm, they ARE undirected. It is the FITNESS FUNCTION that is manipulated to get the desired outcome. Programming imitates Natural Selection because it is so powerful.

    If you think your analogy is good, your ID is Creationism, pure and simple. If you think the PRODUCTS of life are designed, your analogy sucks. The programmer in your analogy did NOT program/design the PRODUCT of the evolutionary algorithm. 

    If your ID is not anti-evolution, then why attack the Tiktaalik and try to make it sound out of place by misunderstanding its position as a transitional fossil? Surely, your ID evolution also requires Tiktaalik to be in the right place? You are not consistent.

    You accept all the necessary components of evolution by Natural Selection EXCEPT undirected mutations, so you should spend 100% of your efforts demonstrating that undirected mutations cannot produce functional outcomes. Instead, you keep harping on about evolutionary algorithms, which clearly demonstrate that they CAN. So, you have no problem with the theory of Natural Selection – the POTENTIAL. The only thing left is to go after the mechanisms we see in action – mutation. But EVERY conclusive experiment ever conducted has indicated that undirected mutations is all there is. (Unless the system has evolved a genetic switch to a recurring scenario.) Indeed, it used to be a question that was up for grabs before some landmark studies in the 40′s and 50′s – results that have been backed up countless times since and are now being validated in exquisite detail by whole genome sequencing studies. You have NOTHING.

    [Edit: missed an important "no"! p]

  • JohnM

     Jonathan :

    This is the arms race process of evolution. It’s why the top fastest animals on earth are made up of both predators and prey. This paragraph actually supports evolution. Though you would know that if you knew your evolution well enough!

    What arms race? Think about it, Jonathan.

    If the Gazelles were to gain the upper hand, then the Cheetahs would soon starve to death. The Gazelle population would explode, and there wouldn’t be enough food for them to survive the winter.

    If the Cheetahs were to gain the upper hand, then their population would explode, and all the  Gazelle would be eaten.. And then the Cheetahs would have a hard time finding prey.

    Both their continuous existence, relies on a delicate balance between the two.

  • frisbee_kid

    Tell you what. Instead of random.org generating a DNA sequence, just put a bunch of nucleotides in a flask and see what forms. Then post the sequence and put that up against the human sequence.

    Yes, that’s an excellent idea. Let’s put a bunch of nucleotides in a flask and see what forms. You know what forms Joe?
    RNA-based enzymes. 100 base strands of RNAThousands, millions, billions of them. Until one forms that can catalyze the reproduction of another one… or itself.
    Joe, I’ve been posting papers that have been doing this for over two years now. Haven’t you read them?

    I asked for DNA NOT RNA. Geez you can’t even understand one sentence.

  • frisbee_kid

    To Andy and Kevin-

    Read the OP, then buy a vowel. The OP sez the prediction was fulfilled because Tiktaalik was found at the correct TIME. Shubin said he looked where he did because he did not think tetrapods were around before then.

    No one looks for a transitional form millions of years AFTER the transition occurred. that is because there isn’t anything in the theory that supports the claim.

    Shunbin’s entire chapter one was to set up the TIMING of the transition. Don’t blame me because you are too stupid to grasp what he set out to do- HINT- he did NOT set out to find any ole transitional form. He set out to find evidence of THE transition, which according to Shubin, includes the TIMING of the event.

  • frisbee_kid

    Richard Edwards,

    You are confused as evolutionary algorithms support my position and they do not contradict it. The products ARE designed. They evolved BY DESIGN.

    Also I am NOT attacking Tiktaalik. I am just stating the FACTS- what is wrong with you?

    And why don’t YOU spend some time demonstrating that natural selection can actually construct multi-protein systems? Your position has nothing Richard. It can’t even show that Tiktaalik was the result of natural selection nor genetic drift.

  • frisbee_kid

    Kevin:

    Oh yes, of course, that’s what you said. Oh well then, it’s a good thing that no living or past scientist or person who studies biology thinks that evolution is only “blind and undirected processes”. For the billionth time… there’s this thing called selection. No matter how many times you quotemine someone else or declare the “natural selection is a result, not a process”, it doesn’t make it true.

    Kevin, I have supported my claim on several occasions and you just ignored my references. You are deluded.

    Natural selection is blind and mindless. It is just the result of three processes. Mutations are undirected. Tha means every evolutionary biologist understands that the ToE posits blind and undirected processes.

    And Kevin, as I have told you already, I do NOT care what YOUR position is. You are no one wrt science and biology. I am going after mainstream’s theory of evolution.

  • frisbee_kid

    ID is OK with mutations accumulating and bringing about changes. Again, the changes would be directed, part of the plan.

    Andy:

    That would be anti-evolution because it contradicts a key tenet of evolutionary theory.

    Dude you are DENSE- yes ID is against the THEORY of evolution but not evolution itself. The two are NOT the same.

    Mutations are random wrt fitness.

    Meaningless drivel. Mutations can be random wrt fitness and still be directed.

     This is a well documented fact and no one so far was able to show any evidence to the contrary.

    Unfortunately no one knows if any mutation is random in any sense of the word.

  • frisbee_kid

    “And Kevin your quotes say that ID is anti-DARWINIAN evolution- just as I have said. As my post proves, all the ID leaders say ID is OK with “evolution”. So get a life already. “

    You’re trying to get away with one of your usual tricks there joey

    Facts are NOT tricks. And your ignorance is not a refutation. 

  • frisbee_kid

    Tiktaaalik, as much as you hate it, is a transitional form. Evolution predicts exactly in what age of rock you should find fish becoming land tetrapods. Neil Shubin went to the arctic because he knew precisely where to look.

    1- transitional form boils down to “it looks like a transitional form to me”

    2- Tetrapods existed millions of years BEFORE Tiktaalik

    3- Shubin was looking in the wrong strata to find what he said he was looking for

    We know that random mutations followed by natural selection can lead to new species.

    There isn’t any evidence it can change a fish into a fish-a-pod

  • frisbee_kid

    And it is nice to see that Kevin can still ignore reality:

    BTW, Kevin, forensic science claims to be able to tell design from not. So by your “logic” forensic science is useless if a forensic scientist cannot answer your challenge. Archeaologists claim to be able to determine design from not also. Geez Kevin, you are blowing away valid fields of science with one strawman!

    Nothing to say about that, Kevin? Cat got your tongue? Geez you are very mouthy when your strawman isn’t exposed…

  • frisbee_kid

    According to evolutionary biologists natural selection and genetic drift are blind, mindless processes. And the mutations that feed them are totally undirected, ie left to chance.38 Nobel Laureates say:

    Logically derived from confirmable evidence, evolution is understood to be the result of an unguided, unplanned process of random variation and natural selection.

    Natural selection is said to be blind and mindless. Just what direction is a blind, mindless, unguided and unplanned process going to produce?

    So here is the evolutionary references to support my claim:Eric B Knox, “The use of hierarchies as organizational modelsin systematics”, Biological Journal of the Linnean Society (1998), 63: 1–49:

    Evolution is rife with examples of such apparent conflict because it is an inherently dualistic process. This dualism is obvious in Darwin’s enduring characterization of evolution as descent with modification. This dualism is manifested in a mechanism that is prospectively blind, but retrospectively capable of organic improvement. page 4 (bold added)

    Then we have:

    “Natural selection is the blind watchmaker, blind because it does not see ahead, does not plan consequences, has no purpose in view.” Dawkins in “The Blind Watchmaker”

    and:

    “Natural selection is the simple result of variation, differential reproduction, and heredity—it is mindless and mechanistic.” UCBerkley

    From the “Contemporary Discourse in the Field Of Biology” series I read- Biological Evolution: An Anthology of Current Thought, (edited by Katy Human). This is part of a reviewed series expressing the current scientific consensus.

    Uncertainty, randomness, nonlinearity, and lack of hierarchy seem to rule existence, at least where evolution is concerned.- page10

    The old, discredited equation of evolution with progress has been largely superseded by the almost whimsical notion that evolution requires mistakes to bring about specieswide adaptation. Natural selection requires variation, and variation requires mutations- those accidental deletions or additions of material deep within the DNA of our cells. In an increasingly slick, fast-paced, automated, impersonal world, one in which we are constantly being reminded of the narrow margin for error, it is refreshing to be reminded that mistakes are a powerful and necessary creative force. A few important but subtle “mistakes,” in evolutionary terms, may save the human race. -page 10 ending the intro

    What Causes Mutations?:

    Mutations in DNA sequences generally occur through one of two processes:1. DNA damage from environmental agents such as ultraviolet light (sunshine), nuclear radiation or certain chemicals2. Mistakes that occur when a cell copies its DNA in preparation for cell division.

    Causes of Mutations:

    1. DNA fails to copy accuratelyMost of the mutations that we think matter to evolution are “naturally-occurring.” For example, when a cell divides, it makes a copy of its DNA — and sometimes the copy is not quite perfect. That small difference from the original DNA sequence is a mutation. 2. External influences can create mutationsMutations can also be caused by exposure to specific chemicals or radiation. These agents cause the DNA to break down. This is not necessarily unnatural — even in the most isolated and pristine environments, DNA breaks down. Nevertheless, when the cell repairs the DNA, it might not do a perfect job of the repair. So the cell would end up with DNA slightly different than the original DNA and hence, a mutation.

    DNA Replication and Causes of Mutation:

    DNA replication is a truly amazing biological phenomenon. Consider the countless number of times that your cells divide to make you who you are—not just during development, but even now, as a fully mature adult. Then consider that every time a human cell divides and its DNA replicates, it has to copy and transmit the exact same sequence of 3 billion nucleotides to its daughter cells. Finally, consider the fact that in life (literally), nothing is perfect. While most DNA replicates with fairly high fidelity, mistakes do happen, with polymerase enzymes sometimes inserting the wrong nucleotide or too many or too few nucleotides into a sequence. Fortunately, most of these mistakes are fixed through various DNA repair processes. Repair enzymes recognize structural imperfections between improperly paired nucleotides, cutting out the wrong ones and putting the right ones in their place. But some replication errors make it past these mechanisms, thus becoming permanent mutations. These altered nucleotide sequences can then be passed down from one cellular generation to the next, and if they occur in cells that give rise to gametes, they can even be transmitted to subsequent organismal generations. Moreover, when the genes for the DNA repair enzymes themselves become mutated, mistakes begin accumulating at a much higher rate. In eukaryotes, such mutations can lead to cancer. (bold added)

    Yes the ToE posits evolution proceeds via blind and undirected processes, Kevin.

  • The whole truth

    JohnM, it seems to me that it is then also impossible to point at something in nature and say “it’s designed” without knowing what the “goal” is.
    Speaking of the “goal”, can you tell me ‘the designer’s’ goal in designing-creating malignant cancer cells and other diseases in children? And can you tell me ‘the designer’s’ goal in designing-creating conjoined twins and people or animals born with two heads or other deformities and disabilities? I await your easy explanation.  

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    @disqus_VpcCfzNZjQ:disqus 
    This shows you really are ignorant of evolution:

    What arms race? Think about it, Jonathan.
    If the Gazelles were to gain the upper hand, then the Cheetahs would soon starve to death. The Gazelle population would explode, and there wouldn’t be enough food for them to survive the winter.
    If the Cheetahs were to gain the upper hand, then their population would explode, and all the  Gazelle would be eaten.. And then the Cheetahs would have a hard time finding prey.

    Start here:
    Evolutionary Arms Race

  • The whole truth

    Hey joey/frisbee_kid, 

    This is 2012. The religious beliefs of Linnaeus are irrelevant to current taxonomy. Science progresses, and yeah, taxonomy (systematics)  and the ToE have progressed and continue to progress, unlike your antiquated religious beliefs. Bringing up the religious beliefs of long dead people in an attempt to support your religious/political agenda (ID) is lame. 

  • SmilodonsRetreat

    Same ole same ole.

    JohnM… what you have described is population dynamics.  This is a concept that was developed by evolutionary biologists to help them understand just the things you are talking about.

    Do you claim that it is evidence of design?  If so, then please provide the ID explanation for the adaptation that evolution readily explains.

    Do you think that there is a goal for life?  If so, what evidence do you have?  What predictions can you make about the future of life on the Earth based on this evidence and your knowledge of ID?

    Evolution can be used to predict those things.  If ID wants to play, then ID has to do at least that.

  • frisbee_kid

    No Kevin, blind watchmaker evolution doesn’t predict anything. You are sadly mistaken, as usual.

  • frisbee_kid

    I don’t have any religious beliefs nor any religious/ political agenda.

    You are just upset because you cannot support your position. Deal with it.

  • frisbee_kid

    Evolutionary arms race- talk about an ad hoc explanation…

  • frisbee_kid

    And JohnM- cheetahs would eat something else if they could not get a gazelle.

  • The whole truth

    Hey joey/frisbee_kid,

    You said:

    “ID is OK with mutations accumulating and bringing about changes. Again, the changes would be directed, part of the plan.”

    Does that include macro changes (e.g. ‘macro evolution’) and are “all the ID leaders” and you and all other ID-creationists “OK” with macro evolution? 

  • frisbee_kid

    Macro-evolution by DESIGN has always been accepted by IDists. However there isn’t any evidence to support it. So that would be a problem.

  • SmilodonsRetreat

    Good thing Blind Watchmaker evolution only exists in your world.

    Joe, you’ve been saying the exact same things for well over two years now.  Just out of curiosity, are you ever going to understand that the things you say aren’t correct?

  • frisbee_kid

    Kevin,

    Strange that I have referenced my claims about blind watchmaker evolution = the theory of evolution. IOW you are a deluded dolt and a liar.

    So perhaps you should reconsider…

  • frisbee_kid
  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    “Evolutionary arms race- talk about an ad hoc explanation…”

    What? Do you even know what ad hoc means?

    We can witness EAR within superbugs. Take MRSA. We act as the predator. As we up the antibiotics, the strains mutate resistance, so we create better antibiotics, so the strains become even more resistant and so on. 

    http://www.bbc.co.uk/news/science-environment-11010458

    Or “Most of us rely on antibiotics when we get sick. But some bacteria have become resistant to commonly used antibiotics, and even more alarmingly, some “superbugs” can withstand a host of different medications. A sobering case in point is Staphylococcus aureus. As this time line shows, strains of Staph aureus have gotten the better of every antibiotic we’ve developed. Here, follow this ongoing arms race and learn about its unsettling implications.”
    from
    http://www.pbs.org/wgbh/nova/evolution/arms-race-superbug.html

  • frisbee_kid

    Good thing Blind Watchmaker evolution only exists in your world.

    Richard Dawkins, a leader amongst evolutionists, proposed it based on his understanding of the theory. YOU are nobody wrt science and biology. And Dawkins has the support of people like Jerry Coyne. OTOH you have nothing.

    Joe, you’ve been saying the exact same things for well over two years now.

    Longer than that. “The Blind Watchmaker” came out in the 1990s.

    Just out of curiosity, are you ever going to understand that the things you say aren’t correct?

    I am repeating what evolutionary biologists say. I have referenced their claims. You just ignore all that and prattle on as if your ignorance is a refutation.

    Do you really think people don’t notice?

  • SmilodonsRetreat

    blahblah blah…

    Just out of curiosity, do you think that defeating evolution makes ID correct?

    But, once again, thanks for the own goal.  You have previously claimed that natural selection is a result not a process.  If we use the pages you selected, then we find that natural selection is a process… which you claim not to be the case.

    So, we can have dueling quotes all day long. 

    ID still doesn’t have anything.

    From the other document you quoted:
    “In contrast, intelligent design is fundamentally unscientific; it
    cannot be tested as scientific theory because its central conclusion is based on belief in
    the intervention of a supernatural agent.”

    So, which is it Joe?

  • frisbee_kid

    Kevin,

    As I have been telling you it is mandatory for any design inference to first eliminate necessity and chance.

    Natural selection is a result that can also be described as a process-> ie differential reproduction due to heritable random variation.

    ID does NOT require the supernatural. And ID has more than your position will ever have.

    And I have told you how to test and falsify ID. IOW you have serious issues…

  • frisbee_kid

    And please let’s see your out-of-context/ quote-minied “dueling quotes”

  • frisbee_kid

    The ad hoc is saying natural selection didit. As I have been trying to tell you as far as anyone knows it is by design.

  • SmilodonsRetreat

    Do you know why, Joe, that biologists HAVE to say that evolution is unguided and ‘blind’?

    Because as soon as someone uses the word ‘guided’ or ‘selected’ or any other word that actually applies to evolution.  People like you shout it from the rooftops as vindication of their point of view.

    Unfortunately, they are still wrong, because there is a big difference between guided in terms of natural laws and guided in terms of an intelligent agent directing the whole thing.

    That’s the part that people like you don’t get.  Would you say that a river is ‘guided’ or ‘unguided’.  Well, arguably, it’s both.  It is guided by the banks of the river and by gravity.  It is not guided by an intelligence.

    So, let’s look at it that way.  All of our argument can be settled by one thing.

    Provide evidence of a guiding intelligence.  You know, that “Intelligent” part of “intelligent design”.  If you can do that, then all the arguments stop.

    But you know you can’t.  And regardless of all our arguments on semantics (because that’s all it is really), evolution is still being used to produce things and ID isn’t.  Evolution works, ID doesn’t.  And that’s all there really is to it.

  • SmilodonsRetreat

    Sorry Joe.  I’m done with you.  We’ve been having this same argument for two years and you use the same stuff you’ve been using for that entire time.

    Bye Joe.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    HA HA HA AH AH AHAH AHAH AHA HAHA HA

    “As I have been trying to tell you as far as anyone knows it is by design.”

    Er, that is the very definition of ad hoc. And it fails Ockham’s Razor.

  • Andy_Schueler

    Shunbin’s entire chapter one was to set up the TIMING of the transition. Don’t blame me because you are too stupid to grasp what he set out to do- HINT- he did NOT set out to find any ole transitional form. He set out to find evidence of THE transition, which according to Shubin, includes the TIMING of the event.

    No, he didn´t and I´m too bored to explain it to you again. Get an education and until then fuck off you lying piece of shit. 

  • The whole truth

    joey/frisbee_kid said:

    “Ya see SCIENCE is all about making observations in the REAL WORLD and then trying to explain them.”

    Okay joey, let’s say that you observe a baby with Down syndrome. How do you explain it using “ID” science? 

    “BTW forensic science claims to be able to tell design from not.”

    Human design joey, human design. Neither archaeologists nor forensic scientists (at least reputable ones) claim to be able to determine supernatural sky daddy design. And forensic scientists do not claim to be able to ALWAYS determine human design (or not) in every investigation. That’s one of the reasons that a lot of crimes go unsolved.  

  • Richard Edwards

    @google-8099882c039d23abd84d1b0244de0872:disqus Your “Designer of the gaps” argument is pitiful and your inability to grasp how evolutionary algorithms work is astounding. But congratulations for successfully trolling and dominating another comment thread! (I’m out of this one. I have some evolutionary biology to do. Hooray!)

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    easy…

    Having said that, Joe, you MUST start taking on what people have said rather than steadfastly ignoring comments time and again.

  • frisbee_kid

    Yes he did:

    Chapter 1 is the set up for Neil’s journey to find the origin of limbed organisms. That’s right, according to Neil he was “interested in understanding the origin of limbed animals”, not just any ole transitional form. And he said, wrongly as it turns out, that to find the origins of limbed animals “we can now restrict our search to rocks that are roughly 375 million to 380 million years old”.First, the set-up:

    “In a nutshell, the ‘fish–tetrapod transition’ usually refers to the origin, from their fishy ancestors, of creatures with four legs bearing digits (fingers and toes), and with joints that permit the animals to walk on land. This event took place between about 385 and 360 million years ago toward the end of the period of time known as the Devonian. The Devonian is often referred to as the ‘Age of Fishes,’ as fish form the bulk of the vertebrate fossil record for this time.”- Jennifer Clack, The Fish–Tetrapod Transition: New Fossils and Interpretations; “Evolution: Education and Outreach”, 2009, Volume 2, Number 2, Pages 213-223

    Got that- “the transition” refers to an event, a specific event that occurred between two specified time periods, a time when there were fish and no tetrapods and the time when there were fish and tetrapods. With that now firmly established we return to “Your Inner Fish” chapter 1 where Shubin discusses what he was looking for- hint: evidence for the transition, ie the event:

    Let’s return to our problem of how to find relatives of the first fish to walk on land. In our grouping scheme, these creatures are somewhere between the “Everythings” and the “Everythings with limbs”. Map this to what we know of the rocks, and there is strong geological evidence that the period from 380 million to 365 million years ago is the critical time. The younger rocks in that range, those about 360 million years old, include diverse kinds of fossilized animals that we would recognize as amphibians or reptiles. My colleague Jenny Clark at Cambridge University and others have uncovered amphibians from rocks in Greenland that are about 365 million years old. With their necks, their ears, and their four legs, they do not look like fish. But in rocks that are about 385 million years old, we find whole fish that look like, well, fish. They have fins. conical heads, and scales; and they have no necks. Given this, it is probably no great surprise that we should focus on rocks about 375 million years old to find evidence of the transition between fish and land-living animals.- Neil Subin pages 9-10 (bold and italics added)

    OK he did it just exactly as described, bracketed the dates. However his dates were wrong, which means he did not find evidence for the transition, which occurred many millions of years earlier.

  • The whole truth

    Well then joey, if the ability to determine the difference between a designed thing and a non-designed thing is “VERY important” to “ID” will you please determine whether the things in the following list are designed or not designed by ‘the designer’ and describe in your own words exactly how you do it?

    1. A volcanic eruption. 
    2. A wisdom tooth.
    3. Skin eating bacteria.
    4. An asteroid. 
    5. The Grand Canyon. 
    6. A chimpanzee.
    7. A human being. 
    8. Tiktaalik
    9. The ecosystem of a remote oceanic island. 
    10. A wild banana. 

  • frisbee_kid

    Kevin,

    I provided the references that support my claim. And now all you can do is act like the little cry-baby that you are.

    I have also provided evidence for a guiding intelligence and you just choked on it.

  • frisbee_kid

    How does it fail Ockham’s razor? Please provide the evidence that demonstrates that all genetic change is a chamce event.

  • frisbee_kid

    Richard, YOU are pitiful and it is obvious that you don’t know a damn thing.

  • frisbee_kid

    Yes you are sorry Kevin- sorry, ignorant and a liar to boot…

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Every organism, every bit of evil, EVERYTHING needs explaining in the context of an all-loving, all-knowing designer with knowledge of all counterfactuals, which is what your designer would be, no? On a blind process with no designer what we see needs no explanation. There is no need for another unnecessary level of explanation. Cancer and flesh-eating bacteria are all predictable.

    http://www.skepticink.com/tippling/2012/08/26/ockhams-razor-and-christianity/
    So you admit you were being ad hoc, at least?

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Can we have a little more decorum please. i know you guys have history.

    Joe, perhaps it might be wise to set out what you believe and what you don’t believe. 5 statements of each, perhaps. We will then pick one and bottom it out. Let’s not go round the houses here – slimline.

  • frisbee_kid

    Having said that, Joe, you MUST start taking on what people have said rather than steadfastly ignoring comments time and again.

    But it’s OK to ignore what I post? Grow up…

  • frisbee_kid

    Jonathan-

    I set out to show that your OP is wrong and i have done so. As for what I believe I have a blog full of that.

  • Andy_Schueler

    frisbee_kid,
    several people explained to you in detail why you are wrong on Shubin´s research. You are still repeating the exact same nonsense over and over and over again.
    Since your argument stays completely unchanged in every iteration,  I´ll just quote myself from previous threads:

    Closely related sister groups (i.e. cousins) *are* evidence for the transition and closely related sister groups
    *are* close “relatives of the first fish to walk on land.” and the
    morphology is indeed “intermediate between two different types of
    animal”. 
    What do you expect ? The overwhelming majority of all
    animals don´t fossilize and the overwhelming majority of all lineages go
    extinct – the probability of finding early cousins of one particular
    lineage that still lives on nowadays is *much* higher than finding an
    ancestor who belongs to this exact lineage.
    That´s paleontology 101 – and it´s exactly how the found was presented – and all conclusions that have been derived from the analysis of Tiktaalik are still valid.

    Edit: I just looked up the two nature papers from 2006 where Tiktaalik was first presented to the public:

    http://www.nature.com/nature/journal/v440/n7085/full/nature04637.html
    http://www.nature.com/nature/journal/v440/n7085/full/nature04639.html

    they already say in the abstract(!) that Tiktaalik represents a sister group (i.e. a “cousin”) of tetrapods (finding a fossil of an ancestor of the lineage that lead to the MRCA of tetrapods would be a completely absurd expectation, this is really paleontology 101 stuff..), they were indeed mistaken about how early of a cousin Tiktaalik is to the MRCA of
    tetrapods, but this does not affect their interpretations one bit.

    He used the best data that was available at the time to pinpoint the
    emergence of tetrapods – and this turned out to be too young by a few
    million years, how does this change any of the conclusions that have
    been presented based on the analysis of Tiktaalik ? It still is a very
    close sister group (just not as close as they expected in 2006) and
    shows exactly the “intermediate between two different types of animal”
    that Shubin expected to find. 

    All
    that means is that he could have looked for fossils that are even
    closer related to the MRCA of tetrapods than the one he actually found -
    how does this affect any of the conclusions he presented ?

    I already explained it to you several times, Tiktaalik is no ancestor of tetrapods and no one ever claimed it would be one. Also, no one expected to find one, this would be exceedingly improbable because:
    1. Fossilization is an extremely rare event.
    2. Most lineages die out.
    These two facts mean that most fossils of organisms that lived millions of years ago have no living descendants, they are not ancestral to any living organism, they  are sister groups (i.e. cousins). 
    And
    a close sister group was exactly what Shubin was looking for, it was
    not as close as they expected in 2006, but still very close, and it
    shows exactly the distribution of morphological features that Shubin´s
    group expected. 
    This really is Paleontology 101 stuff…

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    So how is evolution NOT predictive based on Tiktaalik? How is it, then, wrong? 

    If you state, as it seems, that Tiktaalik was predated by a tetrapod in Poland some 10 million years before, how does this invalidate evolution? The prediction still stands. How do you know the Polish line didn’t go extinct as many lines do? Andy has said the rest.

  • frisbee_kid

    LoL! It does not invalidate evolution. The “prediction” is NOT fish-> tetrapods-> fish-a-pods.

    What part of that don’t you understand?

  • frisbee_kid

    Andy- You are a COWARD for not responding to what i post.

    I do NOT care that Shubin has changed his mind since the book’s release. I am referring to what he wrote in the book.

    Also Tiktaalik is a cousin by need only.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    I don’t understand if you
    1) merely have a bone to pick with incorrect dating as if science never corrects itself and has to be perfect first time or else it is instantly invalid

    or

    2) have something more intelligent to say

    Take your pick, but be concise and clear.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    No, Andy is spot on. you seem to be concentrating on something which does not warrant such concentration.

  • frisbee_kid

    No, Andy is clueless and is not even reading what i post. Shubin made a specific claim that has turned out to be false.

    For example if had known about the tetrapod tracks in Poland he would NOT have looked where he did when he found Tiktaalik- it wouldn’t make any sense to do so.

  • frisbee_kid

    I am just saying that your OP is incorrect as Tiktaalik was NOT found between A and C.

    Please do at least TRY to follow along.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    But he didn’t know about them then. Given the best evidence, Shubin was able to make a coherent prediction and based on this prediction, he found the fossil he was looking for.

    Which means that now paleontologists can make a further prediction. And the self-correcting scientific method goes on. 

    Of course, it could be that the Polish line went extinct, since this is not uncommon. 

  • frisbee_kid

    And AGAIN-

    There isn’t anything in the theory of evolution that says transitional forms will be around millions of years AFTER the transition occurred.

  • Andy_Schueler

    Also Tiktaalik is a cousin by need only.

    No. It isn´t.
    And Shubin and his co-authors said so in the original nature publication that was written and published long before “Your inner fish” was published and long before the date of the emergence of tetrapods had to be corrected by a few million years.
    They already state this in the abstract:
    “Here we describe the pectoral appendage of a member of the sister group of tetrapods, Tiktaalik roseae, which is morphologically and functionally transitional between a fin and a limb.”
    http://www.nature.com/nature/journal/v440/n7085/full/nature04637.html
    Which I´m now telling you for the third time.
    Also, no research that has even the foggiest clue about what he is doing would ever expect to find a direct ancestor of the MRCA of tetrapods because:

    I already explained it to you several times, Tiktaalik is no ancestor of
    tetrapods and no one ever claimed it would be one. Also, no one
    expected to find one, this would be exceedingly improbable because:
    1. Fossilization is an extremely rare event.
    2. Most lineages die out.
    These
    two facts mean that most fossils of organisms that lived millions of
    years ago have no living descendants, they are not ancestral to any
    living organism, they  are sister groups (i.e. cousins). 
    And
    a close sister group was exactly what Shubin was looking for, it was
    not as close as they expected in 2006, but still very close, and it
    shows exactly the distribution of morphological features that Shubin´s
    group expected. 
    This really is Paleontology 101 stuff…

    And for this stuff I stopped counting how many times I already explained this to you.
    You are like a five year old who can barely count but thinks he can disprove Cantor´s diagonal argument.

    I do NOT care that Shubin has changed his mind since the book’s release. I am referring to what he wrote in the book.

    Yes, and you don´t understand it.

    You are a COWARD for not responding to what i post.

    I responded to your post many times before you even wrote it because you are writing the exact same garbage over and over and over again – I don´t have to change my refutations if you just parrot the same bullshit ad nauseam.

  • Andy_Schueler

     

    For example if had known about the tetrapod tracks in Poland he would
    NOT have looked where he did when he found Tiktaalik- it wouldn’t make
    any sense to do so.

    Of course it would make sense, if he would have known about these results, he still would have looked in freshwater deposits and not marine ones and he still would have checked the middle devonian period, he would have checked sediments that would have been a few million years older, and to quote myself AGAIN:

    He used the best data that was available at the time to pinpoint the
    emergence of tetrapods – and this turned out to be too young by a few
    million years, how does this change any of the conclusions that have
    been presented based on the analysis of Tiktaalik ? It still is a very
    close sister group (just not as close as they expected in 2006) and
    shows exactly the “intermediate between two different types of animal”
    that Shubin expected to find. 

    All that means is that he could have looked for fossils that are even closer related to the MRCA of tetrapods than the one he actually found – how does this affect any of the conclusions he presented ?

  • The whole truth

    You never cease to amaze me joey with your lies and contradictions. You know damn well that most or all “IDists” do not accept ‘macro evolution’ by design or ‘macro evolution’ in any other way. Most or all “IDists” believe that each ‘kind’ was created by the alleged sky daddy yhwh, and you are a a weird mix of a muslim/christian creationist baraminology pusher. Directly created ‘kinds’ is not evolution nor evolution by design. 

    And tell me joey, are you saying that there’s no evidence of macro evolution and so that would be a problem for “IDists” even though “IDists” have always accepted macro evolution or are you saying that there’s no evidence of macro evolution by design and so that would be a problem for “IDists” even though “IDists” have always accepted macro evolution by design? 

    I have to go now joey but I’ll check back later to see what you’ve conjured up to add to your foolishness. 

  • GearHedEd

    Say for example, that we have a Cheetah. It can run down a Gazelle. The Gazelle dies.. So it must be bad design right? But what if it was faster? Then the Cheetah would starve to death, and then it would be bad design.

    You prove evolution again! It’s no coincidence that the speed/agility of gazelles and cheetahs is so closely matched. Gazelles that are healthy and strong can escape; cheetahs that are healthy and strong can catch and eat gazelles. It’s a symbiotic relationship. Slower cheetahs DO starve (leaving strong, healthy ones to breed their genes into the next generation), and slower cazelles DO get caught and eaten (allowing faster gazelles to reproduce and pass their genes to the next generation).

    You’re right–it IS more complex. More complex than saying, “It appears to have been designed, therefore God”.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    I think this paper refers to the Polish tracks:

    “Tetrapods evolved from sarcopterygian fishes in the Devonian and were the first vertebrates to colonize land. The locomotor component of this transition can be divided into four major events: terrestriality, the origins of digited limbs, solid substrate-based locomotion, and alternating gaits that use pelvic appendages as major propulsors. As the sister group to tetrapods, lungfish are a morphologically and phylogenetically relevant sarcopterygian taxon for understanding the order in which these events occurred. We found that a species of African lungfish (Protopterus annectens) uses a range of pelvic fin-driven, tetrapod-like gaits, including walking and bounding, in an aquatic environment, despite having a derived limb endoskeleton and primitively small, muscularly supported pelvis. Surprisingly, given these morphological traits, P. annectens also lifts its body clear of the substrate using its pelvic fins, an ability thought to be a tetrapod innovation. Our findings suggest that some fundamental features of tetrapod locomotion, including pelvic limb gait patterns and substrate association, probably arose in sarcopterygians before the origin of digited limbs or terrestriality. It follows that the attribution of some of the nondigited Devonian fossil trackways to limbed tetrapods may need to be revisited.”

    http://www.pnas.org/content/early/2011/12/08/1118669109

    Behavioral evidence for the evolution of walking and bounding before terrestriality in sarcopterygian fishesHeather M. King1, Neil H. Shubin1, Michael I. Coates, andMelina E. Hale

  • GearHedEd

    The point of ID is to determine if an agency was involved in some way.

    Wrong. The point of ID is that it presupposes a designer, and attempts to work the explanation backwards from there.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Too true, Ed.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    The scientific method says, “Here are the facts. What conclusions can we draw from them”
    The creationist method says, “Here is the conclusion. What facts can we find to support it”

  • GearHedEd

    A transitional species is most certainly capable of continuing to exist even after the transition. Shubin gave dates that were good enough to bracket his search- 385 mya to 360 mya. This 25 million year long period is broad enough to include pre-transitional, transitional AND post-transitional phenotypes all in the same strata, yet you harp on as if there could be post-transitional species ONLY after the transitional species HAD COMPLETELY DIED OUT. The truth is that ALL species are transitional, but you paint a picture of evolution that resembles a Pokemon game: before, during, after. There is nothing in evolution or the Theory of evolution that requires this, and this makes your position just flat wrong.

    A transition is not an EVENT; it is a transition.

  • GearHedEd

    If Shubin can be faulted for anything at all, it might be that he called Tiktaalik the “most recent common ancestor” before all the evidence was in.

  • JohnM

    SmilodonsRetreat :

    Do you claim that it is evidence of design?

    As I said earlier, my position is based on this:

    TTGGCGTAATCATGGTCATAGCTGTTT
    01000101010101010101010101010101010

    And if you don’t get it, then watch this:

    http://www.youtube.com/watch?v=CamNoA6Cfjc

    http://www.youtube.com/watch?v=wcHp_LWGgGw

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    “Complexity” doesn’t prove design. Evolution by natural selection produces this.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    Creationists and ID advocates like to say “complexity, complexity, complexity”, THEREFORE design. 

    http://www.youtube.com/watch?v=ba2h9tqNYAo

  • JohnM

    Well.. There’s many ways that one can sail about shooting cannonballs at the sinking ship…

    I really like John Lennox’s way of approaching the whole issue.. Maybe, because I’m a math guy myself, and feel right at home when he begins to talk about chance and probability. This video, for example, is a devastating critique of RD and others…

    http://www.youtube.com/watch?v=NiZd2EH5XaA

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    JohnM,
    Trust me dude, your ship has sunk.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    You are confusing abiogenesis with evolution (random mutation coupled with natural selection). Don[‘t confuse “origins” with life evolving. Additionally, you are suggesting that natural selection is just “chance”. You are hugely mistaken and in gross error. This makes me wonder if you even understand evolution.

  • GearHedEd

    I think it’s safe to say that anyone who adheres to ID/creationism does not (and willfully so!) understand evolution.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    What is more ironic is Christians are ‘suppose’ to be people of ‘truth’. But more times than not, they are the very opposite.

  • JohnM

    You are confusing abiogenesis with evolution (random mutation coupled with natural selection). Don’t confuse “origins” with life evolving.

    ?!?! Where? Please quote.

    Your refutation of evolution fails as it does every time creationism is evolution’s supposed replacement.

    ?!?! Where? Please quote.

    Additionally, you are suggesting that natural selection is just “chance”.

    ?!?! Where? Please quote.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    [[I'm confused??!?! Where? Please quote.]]

    Everywhere. Your lack of acument on evolution is coming through with everything you write (or parrot rather).

    [[My refutation?!?! Where? Please quote]]

    In all your presented youtube videos, in all your long winded amateur, sophomoric rebuttals. 

    [[What suggestion?!?! Where? Please quote.]]

    Implicit in your John Lennox video. This article is about EVOLUTION, your video is anything BUT.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    Why are you here JohnM? For a Christian you sure spend more time here with us atheists than you do fellowshipping with your brothers and sisters. What do you hope to achieve? If its to debate, forget it, you fail miserable. Is it to preach? Forget that as well. Is it to learn? Well your inability to employ or listen to reason prevents that.

    Why pray tell, are you here?

  • JohnM

    I’m here because it’s a nice distraction, when I need a little break from coding.

    And John Lennox actually says the opposite of what you are calming, in the video, in regards to evolution being “random”. But how would you know? You didn’t bother to watch it. You prefer being ignorant.

  • Richard Edwards

    The Lennox video is interesting but he gets some very key things very wrong. He confuses abiogenesis with evolution. Indeed, he says at the beginning that they are different and that “evolution” should not be used for abiogenesis but that people do – only Creationists in my experience – and then goes on to do it throughout. Theistic evolution offers nothing for me but it would not challenge any of my evolutionary biology. How life started and how life evolved are two very different questions.

    His other big mistake, which is kind of shocking for a mathematician, is to ignore any Bayesian probability theory in his conjecture about probabilities. In every case, he assumes that we are trying to calculate the probability of this specific outcome from an a priori expectation of this specific outcome. This is true for the anthropic principle (and an infinite number of Universes is just a probable a priori as an infinite god) but even more so for his poo-pooing of Natural Selection by saying the information is in the system. It isn’t, because Natural Selection is not working towards a specific goal – e.g. the human genome – that just happens to be the product of the unguided (in terms of no *target*) but non-random (in terms of differential reproduction providing a *direction*). A river is not trying to flow to its specific estuary but that does not mean that its flow does not have local direction imposed by gravity and geography.

    He also makes the other key ID error of extrapolating from an unproven assumption that life was designed. Essentially, the argument is that every non-living thing we see that looks designed was – by us – so living things that look that way must be too. But that’s totally false because non-living things don’t evolve so the extrapolation does not hold. The same with his information and language. Natural Selection does add information. Saying that no systems without selection have information added except by design is, again, irrelevant. Given that we create evolutionary algorithms that mimic selection and add information to the programs/products they evolve – again, just by setting the fitness function, not designing a specific target as in the monkey typing example he discusses – I am not sure how he can maintain this position. (Although at least I understand where JoeG’s confusion comes from.) 

    You could equally say that every design ever seen is the product of a complex brain, which has evolved, therefore I extrapolate that every designer must have evolved and life (evolving replicators) must precede design because that is the ONLY way to increase information. (In fact, I believe that people do make a similar argument.)

    As with all ID, it starts with the unproven assumption that it is more likely that a designer appeared from nowhere or always existing than an infinite number of universes appeared from nowhere or always existing. Why? They are both pretty crazy ideas. We are here, so one of them has to be true but we have absolutely NO way of determining which is more likely because we no way of testing any of the assumptions we might make to estimate the relative probabilities. As with all Creationism and ID, it is just “designer of the gaps” – a conjured “explanation” (with no predictive power) for a perceived lack of explanatory power of current knowledge but without adding any explanatory power, just moving the question to “where (and why) did the designer come from”? The only motivation for this – as is clear throughout the Lennox video – is a religiously motivated presupposition or need for the existence of a deity.

    Other comments: 
    - He is right about evolution being an observation and a process and the two needing to be considered differently.
    - I am a molecular evolutionary biologist and “molecular evolution” does not mean what he thinks it does at all. (abiogenesis again)
    - Macro- and micro-evolution is a false dichotomy – it is a continuum, not a division. There are a whole range of different sizes of mutation and effects. You cannot draw a line between them any more that you can biologically define the moment a baby becomes an adult, even though the extremes are obviously distinguishable.
    - I agree with some of the points regarding the observed versus the inferred but he is wrong that there is no mechanism for inferred past evolutionary events. We have lots of molecular and developmental mechanisms that COULD give rise to these “macroevolutionary” changes, we just haven’t observed those specific past changes because they were in the past. Selection and “microevolutionary” changes have produced large morphological changes and reproductive isolation in dogs, for example.

  • Richard Edwards

    PS. Whilst feeding the cats, I realised that I myself did a crap job (and mixed things up) discussing the Bayesian business. Lennox is making TWO errors and I combined them – not sure why.

    Bayes first. The problem is that for the things that he is discussing – the Universe looking like us or the analogy of not getting shot by a firing squad – we have know way to estimate the relevant prior probabilities due to missing data – how many Universes (or attempted Universes) are/were there? How many people in the firing squad analogy have stood before firing squads. In each case we start with the posterior observation of life. What that means is that the probability of any prior event that leads to no life becomes zero. With a single observation after the event, we simply have absolutely no way of working out how unlikely it was or, more to the point, the relative likelihood of two unknown possible causes. However unlikely it is that life started, we know that it did, so the posterior probability of life starting is 1.0. (And how can you estimate the probability of god appearing to compare relative likelihoods?)

    The direction versus target thing for Natural Selection is a different error but the key point here is that he is wrong: the information (the target) is not in the system in evolution, even if it is in the monkey example. The monkey example demonstrates the power of selection, not NATURAL selection, so there is an input of specific information towards a specific goal as with artificial selection. The point is that non-random survival of random variants can increase the information in the survivors (at tremendous cost of energy into the system) and the specific information produced does not have to be in the system in the first place. (Although it does need energy, which life gets – and uses – in massive quantities. Without replication and death, there would be no selection and only decay of information.)

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Thanks Richard. It sounds like he makes some of the classic creationist mistakes!

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Richard, an interesting point about calculating Bayesian probabilities for life and non-life in this universe. Without accessing other universes in order to work out priors, it problematic.
    Having said that, on a deterministic framework (as I adhere to), if our background knowledge is TOTAL, then a probability of 1 for everything which happens is always the case!

  • Richard Edwards

    There’s more! (And, I did not yet make it all the way to the video.)

    He doesn’t understand biological information, calling the human genome “the longest word in a any language”. Information in biological sequences is about evolutionary (functional) constraint. The majority of our genome (as a proportion of the letters) has no information at all. As a mathematician or computer scientist, Lennox should understand at least some of this but he does not understand biology – particularly not molecular evolution.

    If he wants to play games of observed versus inferred science and probability… he loses. We have observed less complex things evolve (under controlled selective conditions) more information – an increase of complexity and/or constraint. We have never observed a simple thing create a more complex thing. Nor have we observed a god create anything. These are inferred by adherents to the anthropic principle and thus – by the admission of Lennox – are totally unreliable.

    He also does the old human/life switcheroo – setting out why the Universe seems fine-tuned for LIFE and then making the unsupported leap to assume that this means that the Universe was fine-tuned to create HUMAN life. Wrong! If we re-played the tape of life, we might get something intelligent like humans (we might not) but all current evidence points to the likelihood of evolving humans themselves being infinitesimally small – smaller than his tiny probability of getting the physical constants right for life. Another probability fail by the mathematician due to groundless unquestioned (religiously-motivated) assumptions.

    I feel like I have done a shoddy job of explaining this – it would be interesting to get hold of the transcript and do it properly – and I can appreciate that some of these things are tricky and people can get confused. I especially appreciate this when people like Lennox are out there confusing them. What I cannot appreciate is why they think that the thousands of evolutionary biologists like myself, who have spent our entire adult working lives studying and trying to understand this stuff, – including some (not me!) who are extremely well accomplished mathematicians – get confused by this stuff in the same way. Lennox admits himself that he is no biologist. From his video, he clearly does not understand biology. Show me a mathematician who understands biology and I will show you an evolutionist.

    I also find it interesting (and depressing) that given a video like this, a science-minded individual immediately sets about trying to explain not only why his position is wrong but also why his critique of our position is wrong. The Creationist always ends up just repeating the same flawed assumption and/or misunderstanding. (JoeG being a shining exemplar – thanks, Joe.) As you say, this is all pretty old stuff debunked by those much more eloquent than me many times. This is why, apart from occasional bursts like this to see if the ID crowd have any new arguments (or can actually nali ID down into something clear and consistent), I generally don’t engage in these discussions. There’s too much other stuff we DON’T know to investigate!

    But, @JohhM:disqus , if you REALLY find Lennox’s video convincing, please seek out a real biologists and have a *conversation* (not a shouting match) with them because he really is very wrong and if you take what he says on faith, you will be wrong too. Biology is a fascinating and wonderful subject, made all the more fascinating and wonderful when you understand evolution. (And you can completely ignore abiogenesis if it makes you feel uncomfortable.)

  • The whole truth

    Hey joey, first of all, since you don’t respond to a lot of what is said to you (both here and elsewhere), you must be a “COWARD” according to your own words above. 

    Now, let’s see if you will respond to a few questions, and for the sake of discussion let’s assume that the dating of the tetrapod tracks in Poland and Shubin’s Tiktaalik are accurate. :

    When it comes to a “transition”, do you think that every population of a particular genus or species, no matter how widespread or separated those populations are, all evolve (transition) at exactly the same rate in exactly the same way and at exactly the same time?

    Was Shubin’s Tiktaalik found in Poland? Were the tetrapod tracks found in Arctic Canada? Is there a rule in nature that says that all the prehistoric critters in what is now Poland and in what is now Arctic Canada had to have evolved (transitioned) at exactly the same time in exactly the same way? Is there a rule in nature that says that all fish and fishopods and tetrapods absolutely must evolve (transition) along exactly the same direct line of descent and that there cannot be any branching involved? 

    Since you are an IDiot-creationist and don’t understand or accept common descent, you obviously think that even if some sort of evolution does occur then common descent means that every ‘kind’ MUST be forced to evolve along a totally strict line with no branching whatsoever. To you it’s only A-B-C along that strict line, and nothing can branch off and branch off some more, or die out, or remix (sometimes), or deviate in any way from A-B-C…….

    Have you ever heard of dinosaurs and birds joey? Are all the birds on Earth the direct descendants of the very last dinosaurs? Have bird fossils been found that are older, younger, or the same age as some dinosaurs? Have some bird fossils been found in the same sediments (same formation) as some dinosaurs?

  • The whole truth

    joey, all you have are your religious beliefs, belligerence, lies, and a religious/political agenda (“ID”). Do you actually believe that your history on the internet isn’t available? Do you actually believe that you’re fooling anyone but yourself? 

    You really do need a lot of competent psychological counseling, and a life. Seriously. 

  • The whole truth

    Well, your blog is certainly full of something. 

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    Thank you Richard very much for your well thought responses.  Let me elucidate one thing that Richard has said ” Natural Selection does add information.”

    Sometimes mutations *can* add information to the genome. There are all kinds of
    mutations, point mutations, inversions, insertions, deletions,
    transposition, translocations, frameshift errors, and gene duplications.
    Some of these make copies of existing information, and some *change*
    those copies.

    A ‘copy’ mutation + a ‘change’ mutation DOES increase the genome.

  • Richard Edwards

    Indeed. You don’t even really need the duplication (although it definitely helps) in the “information” sense, you just need to add constraint. Imagine an enzyme that works at regular temperatures. It will have a bunch of residues that are critical for function and cannot be mutated without loss of function. These (or, more accurately, the encoding DNA) contain the “information”. Other sites that can be mutated to a greater or lesser extent without damaging function contain less information. Four-fold degenerate sites (unless codon usage bias is prevalent) contain essentially no information as all nucleotides are tolerated without any problem.

    Now, consider a shift in the environment – or a biochemist doing some experimental evolution in the lab – that adds high temperature stability to the mix. The original enzyme function (and functional constraint) remains but now mutations that increase thermal stability will be favoured and sites that were previously free to mutate will now become constrained. In this way, the information – in the sense that information theorists mean – has increased in the system. And all without any input of information or intelligence – just energy. This is what JoeG (and Lennox) seem to be unwilling or unable to grasp. As long as the environment does not remain static – and competition ensures that it does not – information will continue to be gained (and lost) through time. It is inevitable.

    It is a common misconception (and not just amongst ID advocates) that more letters means more information. It does not, necessarily. It is the randomness of those letters that determines the information content. (This sentence, for example, contains much more information than a whole page of random text.) That said, the *upper bound* to the information is determined by the length, which is why duplication is so important in the big picture – that and the relaxed constraint of duplicates that can allow them to evolve novel functions or subfunctionalise and specialise in different promiscuous activities of the ancestral sequence.

  • Richard Edwards

    @johnnyp76:disqus , I feel that I got myself all tied up when trying to discuss the probability stuff and probably called some stuff Bayesian that isn’t but I agree with you. I am not sure we will ever have TOTAL knowledge, though! I am just always shocked how Creationists seem so happy to assume that the prior probability of there being a god is greater than the prior probability of an infinite (or very large) number of Universes (in time or space) – or, worse, don’t realise that they are doing just that when they invoke the anthropic principle. They just seem happy to assume there is and only ever has been one Universe. OK, so I am not shocked that they do this but I am shocked that they think people should be convinced by it!

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    [[ Creationists seem so happy to assume that the prior probability of
    there being a god is greater than the prior probability of an infinite
    (or very large) number of Universes (in time or space) ]]

    Parallel universes are a PREDICTED consequence of quantum mechanics, It IS speculation, but speculation based on strongly supported theory. Compare that for your speculation for a God for which there is NO precedence.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Did you watch the Jim Al Kalili documentary on information – it’s still on iplayer i think.

  • Richard Edwards

    I’ve not seen that one – looks interesting. Hopefully, I can find time before it disappears.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    I think one of the interesting lines was something like “information is a measurement of unexpectness” or something. 

  • JohnM

    GearHedEd:

    You prove evolution again!

    Not at all. What I’ve done, is to show, that the same evidence, can fit into multiple explanatory frameworks.

  • JohnM

    Richard Edwards :

    He doesn’t understand biological information, calling the human genome “the longest word in a any language”. Information in biological sequences is about evolutionary (functional) constraint. The majority of our genome (as a proportion of the letters) has no information at all. As a mathematician or computer scientist, Lennox should understand at least some of this but he does not understand biology – particularly not molecular evolution.

    If you took a strand of a supercoiled helix, uncoiled it, and decoded it, then surely it would be one of the longest words known to man. There’s a reason why it’s called DNA sequencing.

    To claim Lennox “ doesn’t understand biology” because he uses that type of terminology, is plain and simple, stupid. So grow up.

    As with all ID, it starts with the unproven assumption that it is more likely that a designer appeared from nowhere or always existing than an infinite number of universes appeared from nowhere or always existing. Why? They are both pretty crazy ideas.

    Have you heard about this thing called fine-tuning?

    The problem is that for the things that he is discussing – the Universe looking like us or the analogy of not getting shot by a firing squad – we have know way to estimate the relevant prior probabilities due to missing data – how many Universes (or attempted Universes) are/were there?

    What other universes?

    and an infinite number of Universes is just a probable a priori as an infinite god

    Not at all. There’s no evidence in favour of multi verse theory. And by the very nature, there can’t be any. Multiverse theory is nothing more than a unfalsifiable escape hatch, for people who have a hard time coming to terms with reality.

    With a single observation after the event, we simply have absolutely no way of working out how unlikely it was or, more to the point, the relative likelihood of two unknown possible causes. However unlikely it is that life started, we know that it did, so the posterior probability of life starting is 1.0.

    That’s like saying, that the likelihood of me winning the nation wide lottery, was 1.0, if I happened to do so. Of course that’s not the case. That’s flawed logic.

    You could equally say that every design ever seen is the product of a complex brain, which has evolved, therefore I extrapolate that every designer must have evolved and life (evolving replicators) must precede design because that is the ONLY way to increase information. (In fact, I believe that people do make a similar argument.)

    Such an “argument” assumes that evolution is true. It’s circular logic.

    but even more so for his poo-pooing of Natural Selection by saying the information is in the system.

    Dawkins himself attempted to solve the “monkey problem”, by front-loading the system with information of search criterias.

    It isn’t, because Natural Selection is not working towards a specific goal – e.g. the human genome – that just happens to be the product of the unguided (in terms of no *target*) but non-random (in terms of differential reproduction providing a *direction*).

    That’s just an assertion.

    And yes, mutations are random. And yes, you are starting from scratch. So you have to find some mechanism for the typing monkeys to get to get there.

    The monkey example demonstrates the power of selection, not NATURAL selection, so there is an input of specific information towards a specific goal as with artificial selection.

    What input? Mother natural selection merely picks or discards the random junk that comes out. And the monkeys are still typing.

    He also makes the other key ID error of extrapolating from an unproven assumption that life was designed. Essentially, the argument is that every non-living thing we see that looks designed was – by us – so living things that look that way must be too.

    That’s a strawman of the ID position. I linked video, where Stephen C. Meyer explains the ID position.

  • Richard Edwards

    @johnnyp76:disqus Just watched that show. In terms of this discussion (and ID), I think that the really interesting thing is that information cannot be divorced from the physical world. It has to have something to exist. That immediately kills any notion that the information we have is derived from something beyond or before the physical world and, as far as I can see, totally kills ID. I know there are a few ID advocates who say that the Designer for our planet/system could be alien rather than a deity – Lennox is clearly a deity man, though – but this just moves the problem one back. The physical Universe had to precede information. I’d never really thought of it like that before.

  • Richard Edwards

    @disqus_VpcCfzNZjQ:disqus 

    If you took a strand of a supercoiled helix, uncoiled it, and decoded it, then surely it would be one of the longest words known to man. There’s a reason why it’s called DNA sequencing.

    No you wouldn’t. This would not be a “word”. That’s the whole point. A word carries a specific meaning – specific information. It is a deviation from the random expectation. A human chromosome is simply not like this. I am geneticist, so I know a bit about this stuff. There are bits with specific meaning – information – but there is a lot of random stuff in there too. I am not saying that you could not read it, or that it would not be long, I am saying it is not a word in any language.

    Multiverse theory is nothing more than a unfalsifiable escape hatch, for people who have a hard time coming to terms with reality.

    Like a deist god. The point is, Lennox has based his entire position on the unproven assumption that the existence of god is more likely than the alternative. Given that we exist, the a priori probability of this specific Universe existing is irrelevant, only the relative probability of different things that may have caused this specific Universe. (Bayes again. Look him up.) In this context, I don’t have a horse in this race anyway – it’s irrelevant to the issue of naturalistic evolution versus ID. (Though not science versus ID.)

    Such an “argument” assumes that evolution is true. It’s circular logic.

    It is, yes. That’s exactly my point. It is IDENTICAL circular logic that provides the entire foundation of ID. As a discriminator, it is utterly useless. Instead, we need to assess some evidence for ID for Natural Selection. Only problem: there isn’t any direct evidence of a Designer, whereas we have evidence and observation of “blind” evolutionary processes in buckets. (And flasks.)

    Dawkins himself attempted to solve the “monkey problem”, by front-loading the system with information of search criterias.

    I’d have to look up the specific example to check if he gave that caveat. The thing is, his analogy was showing the power of selection – in this case artificial. In Natural Selection – which the monkeys typing is not – there is no front-loading. A bad analogy does not destroy the truth of it. (I would not use that analogy for Natural Selection, myself.)

    That’s just an assertion.

    That was not “just an assertion”. The statement that a genome is “just happens to be the product of the unguided (in terms of no *target*) but non-random (in terms of differential reproduction providing a *direction*)” is something that has never been shown to untrue in any example ever studied. Ever. This is the conclusion of mountains of evidence in favour of it and not a single bit of evidence directly and unequivocally contradicting it. We can observe both mutation and natural selection in action in modern living systems and every observation we make (in the absence of artificial selection) is consistent with this. Every single one. (As long as you treat Sexual Selection as a special case of Natural Selection, which I do.) I am a geneticist. I have looked at this stuff A LOT.

    What input? Mother natural selection merely picks or discards the random junk that comes out. And the monkeys are still typing.

    If you read the bit of my comment that you quoted, I was saying that the monkeys are NOT natural selection. In Natural Selection, the input into the system is energy, not information. Natural Selection is a very wasteful process compared to straight design. Perhaps you would like to tell me how, within an ID framework, the designer gets the information into the system?

    That’s a strawman of the ID position. I linked video, where Stephen C. Meyer explains the ID position.

    It’s not really a strawman, as I have seen it used by ID advocates. However, I am prepared to withdraw that objection as it is entirely superfluous. Meyer may have another explanation based on a garbled understanding of the relationship of energy, information, natural selection and coevolution.  Is he the “Irreducible complexity” guy? That’s even more flawed than the design extrapolation argument. (“Design” of the gaps. Boring.) 

    I’m afraid that I don’t have the stamina for another ID video right now. I am entirely personally, intellectually and academically secure in my position, so I don’t really see what’s in it for me. Feel free summarise the number one killer ID position, though, and I will give it some attention on the off-chance it’s one I’ve not seen before. If it’s more of JoeG’s nonsense about directed mutations, though, I am afraid that is just a wild assertion without a shred of evidence “for people who have a hard time coming to terms with reality”.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    By the way @google-7e5cbfec89a2366b417d4f06dcc8f539:disqus , you were spot on about the title. Schoolboy grammatical error. That annoys me!

  • Richard Edwards

    No one’s perfect!

  • JohnM

    Richard Edwards :

    No you wouldn’t. This would not be a “word”. That’s the whole point. A word carries a specific meaning – specific information.

    A word, is a unit of language.

    TTGGCGTAATCATGGTCATAGCTGTTT…  Is 1 unit. A sequence.

    Just as SuperDuperMumboJumboCrazyWordUp.

    We do have compound words, you know.. NewsStand. SandPaper. ThumbNail.

    So you don’t have a point.

    And even if you had, the claim that Lennox “ doesn’t understand biology”, on the basis of that, is completely ridiculous.

    Like a deist god.

    Belief in the God of the bible, is nothing like the multi verse theory. There’s plenty of evidence that one can look at.. Such as the moral argument. Such as the evidence for the resurrection of Jesus Christ.

    Our faith, is an evidence based faith, unlike belief in muti-verse theory. That you reject the evidence in favour of God, is your problem, not mine.

    The point is, Lennox has based his entire position on the unproven assumption that the existence of god is more likely than the alternative.

    Big bang theory is unproven. Macro evolution theory is unproven. It’s irrelevant whether something is proven. What matters, in a scientific sense, is whether or not the explanation matches the evidence.

    And theism certainly is more likely alternative, to multi verse theory. As I said, due to the nature of the claim, there can’t possible be any evidence in favour of Muti-verse-theory.

    And as any decent mathematician knows, Bayes’ theorem expresses how a subjective degree of belief should rationally change to account for evidence.

    That is why, any calculations using Bayes’  theorem includes the evidence, and alternative explanation of the evidence. That’s what makes Bayes’ theorem a serious model, rather than a 4th grade A/B. And without that, it’s not Bayes’ theorem.

    So on the basis of that, you should know, that any calculation using Bayes’ theorem, will be fatal to the multi-verse theory.

    Given that we exist, the a priori probability of this specific Universe existing is irrelevant…

    That’s the lie, that you keep telling yourself.

    It is, yes. That’s exactly my point. It is IDENTICAL circular logic that provides the entire foundation of ID.

    No. It’s not identical to the foundation of ID. Once again, it’s a strawman.

    Only problem: there isn’t any direct evidence of a Designer, whereas we have evidence and observation of “blind” evolutionary processes in buckets.

    Correction: You interpret the evidence, in such a way, that it leaves no room for a designer.

    But as any scientist would know, the same evidence could easily fit into other explanatory models.

    The statement that a genome is “just happens to be the product of the unguided (in terms of no *target*) but non-random (in terms of differential reproduction providing a *direction*)” is something that has never been shown to untrue in any example ever studied. Ever.

    In other words.. It is true, because it has yet to be proven untrue / false.

    Congratulations. You have just committed a logic fallacy, also know as an argument from ignorance.

    This is the conclusion of mountains of evidence in favour of it

    Correction: A mountain of interpretations, of the evidence.

    But as any scientist would know, the same evidence could easily fit into other explanatory models.

    and not a single bit of evidence directly and unequivocally contradicting it.

    Sure there are. For example, we recently discovered Flesh, on a T-rex Bone. But instead of questioning the falsified framework, people began to question the evidence itself..  And that shows us, that evolution is now a holy cow of some people, within the scientific community.

    We can observe both mutation and natural selection in action in modern living systems and every observation we make (in the absence of artificial selection) is consistent with this.

    There’s no way of showing, that it’s actually “the force of natural selection”, controlling the outcome. And in many cases, such a force has been reduced in influence.. An example being artificial insemination of homosexuals, a “mutation” that was otherwise doomed, as unfit for survival..

    ( by any standard, the hardest judgement of homosexuals, is that of natural selection. Passing on your genes, is “the meaning of life”, according to natural selection. If your fail in doing that, for obvious reason, then your life is pointless )

    And in any case, that’s still a long long way from macro evolution.

    Furthermore, I seriously don’t know anyone who would question micro evolution. Everyone knows that children inherit traits from their parents. Everyone knows that you can breed dogs. And everyone knows that you can mix plant traits.  That is not where the debate is.

    If you read the bit of my comment that you quoted, I was saying that the monkeys are NOT natural selection.

    But you’re wrong. Monkeys, aka random mutations, are the driving force of natural selection. Without them producing junk, there’s nothing to select.

    Meyer may have another explanation based on a garbled understanding of the relationship of energy, information, natural selection and coevolution. Is he the “Irreducible complexity” guy?

    Most people relate “Irreducible complexity” with Michael Behe.

    Wait a minute…   You don’t who Stephen C. Meyer is ??!?!

    I’m sorry to be blunt, but this just shows how ignorant you are about ID. At least know something about the things you are criticizing.
     

  • JohnM

    test

  • Richard Edwards

    I am ignorant of which of the individual advocates of ID propose which aspect, yes. Fortunately, ideas stand by themselves, it does not matter who has them.

    asiugdfadgfadsyugfkasdfjgfs   is not a word. If you cannot appreciate this key difference – and what information really means in a biological context – further dialogue is pointless.

    Random mutations underlie NS, yes. But in the monkey example that Lennox argues aganist, a SPECIFIC outcome was PRE-DETERMINED. This is NOT true for NS. If you cannot appreciate this key difference, further dialogue is pointless.

    At least know something about the things you are criticizing.

    A few comments here:

    1. The same applies to you regarding evolutionary biology and genetics. I have studied these things as a full time job for 14 years (plus undergrad) and I can tell you that you are quite wrong about a great many things. As I said before, I have complete personal, intellectual and academic (and professional) security in this, so I do not feel the need to convince you if you stubbornly refuse to accept it. As with most of your comments, your comment about homosexuals shows that you no nothing of (or choose to ignore) inclusive fitness (kin selection), pleiotropy (things having multiple effects), variation, heritability, the role of the environment and multifactorial inheritance (if many things including environment inputs adding up together to form a trait, it won’t be optimal in all individuals). If you cannot appreciate this, further dialogue is pointless.

    2. Unlike you, I acknowledged my lack of knowledge in this area and asked you for more information. But rather than actually providing something positive, you just went for the cheap ad hominem. I think I understand ID. Nothing that you have written leads me to believe otherwise but I am open to the notion that I have missed something. You, however, refuse to even provide what you think is the most important ID. If you won’t even say what YOU think when asked but keep fobbing people off onto long videos that apparently (but, I suspect, don’t) contain the answer, further dialogue is pointless.

    But as any scientist would know, the same evidence could easily fit into other explanatory models.

    It all depends what you mean by “easily”. Yes, as scientists we are constantly looking for alternative explanations but we go for the most parsimonious. As any scientist knows, interpretations of evidence are built on a combination of existing theory and assumptions regarding what that existing theory predicts regarding a specific bit of evidence. If the evidence does not agree, we critique those assumptions first and see if they are solid. Only if there are, and we cannot rule out some confounding factor, do we go after the underlying theory. (This is why the old ideas of a Young Earth and special Creation were rejected by science decades ago.)

    Sure there are. For example, we recently discovered Flesh, on a T-rex Bone. But instead of questioning the falsified framework, people began to question the evidence itself..  And that shows us, that evolution is now a holy cow of some people, within the scientific community.

    Actually, this is just scientists doing what you said they should – seeing if “the same evidence could easily fit into other explanatory models”. You can’t have your cake and eat it, here. I am not familiar with this discovery, though. Could you provide a link? (And in what way does it contradict the statement you were contesting that evolution is unguided?! Would it not just contradict when T. rex went extinct?)

    Are you a Young Earth Creationist? This comment about T. rex (and comments elsewhere) makes me suspect that you are. I am afraid that the Creation hypothesis has been soundly refuted many times. Even ID is incompatible with YEC. One of the key events where the Discovery Institute thinks the Designer was involved (according to their Homepage is “the geologically rapid origin of biological diversity in the fossil record during the Cambrian explosion approximately 530 million years ago” – and they are very clear to state that they do not object to evolution, just evolution by Natural Selection (to a greater or lesser extent).

    Anyway… if you have anything new to say, please do. I suspect, however, that further dialogue is pointless.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce
  • Richard Edwards

    “But there is no such things as perfect, intrinsically speaking!”

    Well, yes. Perhaps I should have said: No one goes through life avoiding all of the mistakes that were theoretically avoidable. (Unless you strictly adhere to a fully deterministic framework, in which case I guess I should add “had circumstances been slightly different” or “from the perspective of another agent”.) Better? p

  • JohnM

    Richard Edwards:

    Are you a Young Earth Creationist?

    I am. And I don’t think that it’s a secret. I have said so, numerable times on this blog.

    Even ID is incompatible with YEC.

    Most ID are old earth. But I don’t see the theory of design, incompatible with YEC.

    I am afraid that the Creation hypothesis has been soundly refuted many times.

    Well some would think that, based on current interpretation of evidence. But it’s not like “science” is infallible. And the wonderful thing about “science” is that we, at any time, could discover new evidence, that leads us to conclude otherwise. After all, the motto of “Science” is to question everything, and consider all options. Or at least it was, at one point..

    asiugdfadgfadsyugfkasdfjgfs is not a word.

    It’s not an English word, no. I agree. But that does not exclude it from being a word that carries meaning. There are other languages you know.. Some of them ancient and unknown by now.

    and what information really means in a biological context

    Oki let’s go back to that..  Earlier you said this:

    There are bits with specific meaning – information – but there is a lot of random stuff in there too.

    So..  you have a 4 digit code. Some of it, according to you, carries information. As a computer programmer I can relate to that, as I’m familiar with binary code. Other parts of the code, according to you, is meaningless..

    Now, how do you know that it’s actually random and meaningless? How do you exclude the possibility, that it’s you, who doesn’t recognize the meaning or doesn’t succeed in decrypting the information?

    Random mutations underlie NS, yes. But in the monkey example that Lennox argues aganist, a SPECIFIC outcome was PRE-DETERMINED.

    No. Lennox argues against Richard Dawkins attempt to try and solve the monkey problem. And Lennox points out, Richard Dawkins attempts to solve the problem, by introducing design. Which of course is very embarrassing for good old Richard, given his history of hating on designers.

    As with most of your comments, your comment about homosexuals shows that you no nothing of (or choose to ignore) inclusive fitness (kin selection), pleiotropy (things having multiple effects), variation, heritability, the role of the environment and multifactorial inheritance (if many things including environment inputs adding up together to form a trait, it won’t be optimal in all individuals).

    Sure, you can try and wrap it up to appear less offensive. But looking though the lens of evolution, homosexuals does not pass on their genes, and so mother natural selection has thrown them in the garbage bin. No matter how you look at it, it’s a weak mutation, unfit for life, destined to die off.

    And since homosexuals seems to have a natural weakness to Aids, I guess that’s Mother Natural selection telling us, that she wants them dead as fast as possible. And no, I’m not bashing homosexuals. I’m just looking though the lens of evolution. Because it’s survival of the fittest. And if you’re unfit, then that’s just too bad.. Goodbye!

    I am not familiar with this discovery, though. Could you provide a link?

    http://www.msnbc.msn.com/id/7285683/ns/technology_and_science-science/t/scientists-recover-t-rex-soft-tissue/#.UJVa2YbPaSo

    http://news.nationalgeographic.com/news/2005/03/0324_050324_trexsofttissue.html

    And in what way does it contradict the statement you were contesting that evolution is unguided?!

    It does not question evolution directly. It questions the time-line that some people take for granted. Because we all know, that soft tissue does not survive that long.

    But you and I also know, that macro evolution actually needs that kind of time-line to work. And so it questions macro evolution, indirectly.

    Would it not just contradict when T. rex went extinct?

    Careful now. Most Atheist will burn you alive, for even considering such options

  • Richard Edwards

    I have not frequented this blog much so I do not know what you may or may not have revealed in the past. It does, however, confirm that dialogue is pointless as you have clearly already rejected, ignored and/or misunderstood any science that I could share with you, so what would be the point? Let’s just agree to disagree and save each other a lot of wasted effort.

    (For the record, the simultaneous arrogance and ignorance of your position is astounding. Naturally, it is all the thousands of people who are in the top few percentiles of academic performance and who have studied this carefully over many, many years that are wrong and don’t understand, not you. Amazing!)

  • JohnM

    Arriving at a different conclusion, cannot be described as ignorance.

    As for being arrogant.. I’m not saying that I’m superior to others. I’m just saying, that I disagree with their conclusions. And at the end of the day, I could be wrong. Or they could be wrong. Or we could all be wrong. We are all fallible human beings. And in that sense, we are equals.

    So I fail to see the arrogance. Arrogance is commonly associated with people who consider themselves to be infallible.

  • Richard Edwards

    I’m afraid that believing in a Young Earth goes far beyond “arriving at a different conclusion”. You must either be ignorant of the sheer scale of the evidence stacked against, or wilfully ignoring it, whilst buying into the active lies of the Creationist propaganda machine. (Yes, lies. When I was a Christian at Uni, I received a few pamphlets from the Christian Union (one was called “Bone of Contention”, can’t remember the others) and they were jammed full of mistruths that had been long since debunked.) I was being generous by assuming ignorance.

    Your comments about biology all betray a deeply flawed understanding. Especially the one about homosexual genes being destined to die out. If you actually understood genetics at all, you would realise that this was not true and there are many scenarios in which a genetic predisposition to homosexuality could be maintained in the population by selection. Look up “inclusive fitness”, “pleiotropy”, “dominance” and “pentrance” to get you started. Well, and the one about random sequences in genomes. We can chart how they have changed, look at the variation in populations, analyse mutants, all sorts of stuff. More than that, we know how mutation works. We know how evolution works on a small scale. Combine these things and there is literally no way that a certain amount of random junk sequence will not accumulate, including in humans. 

    Fossils, sediments, anatomy, developmental genetics, radiometric dating, tree rings, genetic coalescence analyses, molecular phylogenies, biogeography, plate tectonics, etc. etc. it ALL thoroughly, overwhelmingly, unequivocally rules out a young Earth. If you cannot see this, you are either deluded or  ignorant of the sheer scale of the evidence against your position. 

    If I was posting comments about physics and a physicist told me that my comments about physics all had a deeply flawed understanding and contradicted not just what he thought but what all physicists (without a political and/or religious) agenda thought – and, had been rejected following (literal in the case of YEC) mountains of evidence to the contrary, I think it would be incredibly arrogant to think: “Those physicists, they don’t understand physics like I do. They must be wrong.” I would do some serious reconsidering of my position.

    But that’s just me. And that’s exactly why when my “Flood Geology” and other lies and nonsense was challenged, I turned to the science rather than the Creationist propaganda. And hence why I am no longer a Creationist, of any flavour. It is untenable.

    And, yes, it is arrogant to suppose that you know better and that the scientists (including many Christian ones) are the ones that are drawing the wrong conclusions. (Isn’t it funny how only religious people look at the evidence and manage to come to that conclusion… and even most of the religious people that look at the evidence don’t?)

  • Richard Edwards

    It’s also brave to bring up HIV because, as a YEC, you must adhere to the view that your “loving God” created HIV, and all other viruses. Thanks to giving us the same genetic code as other animals (for no other good reason), the Creator must have wanted us to get bird flu and swine flu too, killing millions of innocents. Lovely. (Yeah, common ancestry makes so much less sense.)

  • Richard Edwards

    PS. Please explain what you mean by “homosexuals having a natural weakness to Aids [sic]“? That sounds rather dubious to me. Do you mean HIV? And are you just talking about their sexual practices or are you implying there is some kind of inherent biological sensitivity? And why say “mother natural selection” when you mean God? Natural Selection would not “try” to get rid of homosexuals and if (the predisposition to) it really was the selective disadvantage you claim it would not be so prevalent in Nature, so “whichever way you look at it” you are wrong. Again.

  • JohnM

    Richard Edwards :

    You must either be ignorant of the sheer scale of the evidence stacked against, or wilfully ignoring it

    No. There’s a third option. The third option being, that I don’t buy your interpretation of the evidence. And that I interpret the evidence, within another explanatory framework.

    Furthermore, you’re the one spreading propaganda. How many times have you said “mountain of evidence” so far? Do you really think that I can be influenced by such cheap tricks?

    Your comments about biology all betray a deeply flawed understanding. Especially the one about homosexual genes being destined to die out. If you actually understood genetics at all, you would realise that this was not true and there are many scenarios in which a genetic predisposition to homosexuality could be maintained in the population by selection.

    That’s just hypocritical bullshit..  When a weak mutation in a Gazelle causes it to be eaten.. That’s natural selection.. Weak mutations being singled out.. But when homosexuals fail to pass on their genes and reproduce… That’s suddenly something positive for the population.. Why are you so keen on putting a positive spin on it? Just face it.. The hardest judgement of homosexuals, is that of natural selection.

    It’s also brave to bring up HIV because, as a YEC, you must adhere to the view that your “loving God” created HIV, and all other viruses. Thanks to giving us the same genetic code as other animals, the Creator must have wanted us to get bird flu and swine flu too, killing millions of innocents. Lovely.

    No, you see… Within the framework of Christianity, there’s both good God, and evil god.

  • Richard Edwards

    Yes, it is clear that if your first though is that ashjgsdkfgafgewaf might be a word in another language, you don’t buy into the interpretive framework of science. When you see monkeys typing, your framework asks “what language is this monkey poetry/prose written in?” – or at least it would if it had any consistency. (Except that you know as well as I that to interpret all randomness as a potential hidden pattern would be paralysing and useless.) I can give you some books to read if you like (start with Coyne’s “Why Evolution is True” although it is light on molecular data) but, surprisingly, I am not going to repeat the entire scientific literature of the 20th and 21st Centuries here. This is not a question of providing a single sourced fact for a single point – this is the entire body of human scientific knowledge we are talking about here.
    As for the gays thing… it all depends why the gazelle is getting eaten. It is not just you who carries your genes. Go read “The Selfish Gene”. I am not saying that homosexuality would not experience some selection against it, just that if there was a counter-balancing selection for it then it would persist (or even spread) – and that is true for any other trait that you chose to replace “homosexuality” with. You have an incredibly naive view of heredity and selection if you think otherwise. Don’t try to school an evolutionary geneticist on how evolution or genetics works. (I note that you did not ask “how” this could happen, or “why” I would say that, you just repeated your false assertion. You are not here to learn and hence I have no more time for you.)
    BTW, though, the Bible says nothing about your “evil god” ever creating anything. It was God who cursed the Earth when Adam and Eve ate the tree. (And didn’t die in the day they ate it, as God had said… but DID know good and evil, as the serpent had said. Are you are on the right side?)

  • Richard Edwards

    @JohnM, if you had shown any interest in biology, I probably would have dug out some references for you. Just saying “mountains of evidence” is not propaganda, it’s laziness – and you have given me no cause not to be lazy. We both know that your “different interpretive framework” consists of rejecting anything that does not fit with your worldview constructed on a very specific interpretation of the Bible. That’s your choice but it’s about as far away from science as you can get and does beg the question once again… why are you here? What do you hope to gain from this?

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    The annoying thing is that when you produce EVIDENCE he claims that it is merely AN INTERPRETATION OF EVIDENCE. He has a very strange way of assessing evidence – well, he buries his head in the sand! 

  • Richard Edwards

    @Jonathan, I’m more annoyed at myself than JohnM. All the signs were there, which is why I asked for clarification on the YEC thing. If you are YEC, you do not objectively weigh up evidence, it is really is as simple as that. Who’s the more fool? The fool that abandons reason, or the fool that tries to reason with them, knowing full well that they have? If JohnM would just admit that his position has nothing to do with reason or evidence, and everything to do with religion and faith, he would actually have an intellectually honest position. And it is his choice to pick faith over reason, even if I consider it folly of the highest order. It’s the maintenance of the pretence that it’s scientifically viable by distorting and cherry-picking what the science actually says that annoys me. Ho hum. Time to move along, I think. Nothing to see here.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Richard
    I know you told me to leave it, but I am writing an entire post at the moment on JohnM’s matrilineal genealogy thesis. Er, it’s a slam dunk. But he will ignore it somehow.

  • Richard Edwards

    He will ignore it – or reject it – because it does not fit his worldview. For the YEC, as long as they can come up with a *conceivable* explanation for each individual point, they are happy. It does not bother them that if each individual explanation is not very likely then the cumulative probability of all their position as a whole is vanishingly small. As long as there is even a vanishingly small chance that their position can work, they will hold on to it. That is faith. I know this well, because I have been there and done that. (Chuck in a little “His ways are not our ways” and “A doubting man is like a boat being tossed about by the wind” and job’s done.) The problem is, the entire fundamentalist evangelical YEC theology is interconnected, and if you poke a hole in one bit, the whole edifice crumbles. Therefore, they will not – cannot – tolerate any holes. (Again, been there and done that. And poked the hole… I’ll write a de-conversion story for you some time.) I think a new post is a much better use of your time than replying to JohnM’s comments!

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    I would love a deconversion story. i am also editing a book of deconversion stories which you could contribute to, too?

    As for answering issues, I get pissed off that Christians think providing AN answer is the same as providing THE answer.

  • JohnM

    Jonathan :

    I know you told me to leave it, but I am writing an entire post at the moment on JohnM’s matrilineal genealogy thesis. Er, it’s a slam dunk. But he will ignore it somehow.

    You’re the one ignoring the obvious explanation, that clears up everything, matches the evidence perfectly, and makes sense of it all..  Why? Because you’re hell bent on seeing errors.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Please refer comments about it to the post. incidentally, you are the one pleading for a non-literal reading of it since it nowhere states it is an MG!

  • Richard Edwards

    Well, a YEC knows the Bible is right because that’s their starting assumption and therefore any evidence contradicting the Bible must be wrong. (Bayes again.) It is actually a valid position, I just wish they would admit it rather than pretending that Biblical truth is an assumption. ID does the same. It assumes a Designer (as a product of an assume extrapolation) and then tries to find evidence for design (as they say themselves at the DI). They do NOT start with two competing hypotheses and ask which is more likely given the data. (They do not also try to find evidence for no design and see what explains more.)

  • JohnM

    Richard Edwards:

    Time to move along, I think. Nothing to see here.

    Considering that there’s nothing to see, you 2 seems to be posting an awful lot.

    why are you here? What do you hope to gain from this?

    Just about every atheist seems to ask me that..  Why are you so eager to see me gone?

    Who’s the more fool? The fool that abandons reason, or the fool that tries to reason with them, knowing full well that they have?

    What is the matter with you people??!

    That one questions some conclusions, drawn by the scientific community, does not amounts to having abandoned reason. That’s just an absurd position. And worse.. it’s an anti-scientific position.

    Think about how Darwin, had to question some conclusions drawn by the scientific community, in his early years..  Do you see him as a fool who has abandoned reason? No… So at least be a bit consistent in your gibberish complains about me.

    And who’s the greater fool? The fool that denies what is clearly seen in Creation. And no, that’s not an ID position. That’s a  biblical position.

    the Bible says nothing about “evil god” ever creating anything.

    Once again, you’re misinformed. Jesus himself refers to “evil god” as the father of all lies – John 8:44

    Yes, it is clear that if your first though is that ashjgsdkfgafgewaf might be a word in another language

    Listen.. Dna code does not say ashjgsdkfgafgewaf. It says ACTGTGCATGCA. It’s a 4 letter code, like the binary code (0010001110). And a as biologist, you should know a much. Mkay? So spare me your flawed analogies.

    When you see monkeys typing, your framework asks “what language is this monkey poetry/prose written in?

    Seriously, do you have any clue what you’re talking about?

    There is only one language. The language of life. The 4 letter code.

    You are confusing generating the information, with deciphering information. 

    Except that you know as well as I that to interpret all randomness as a potential hidden pattern would be paralysing and useless.

    What randomness? Earlier I asked you this:

    So.. you have a 4 digit code. Some of it, according to you, carries information. As a computer programmer I can relate to that, as I’m familiar with binary code. Other parts of the code, according to you, is meaningless..

    Now, how do you know that it’s actually random and meaningless? How do you exclude the possibility, that it’s you, who doesn’t recognize the meaning or doesn’t succeed in decrypting the information?

    I can give you some books to read if you like

    I’m not asking you for books. I’m just asking you to answer a very simple question, that I just quote. And as a trained biologist, that should be child’s play for you. So drop the smoke-screens and answer the question.

    Go read “The Selfish Gene”.

    Yeah, let’s go and read Dawkins books. But if you actually had done that yourself, then you wouldn’t be unfamiliar with Dawkins attempt to solve the monkey problem. Mkay?

    We both know that your “different interpretive framework” consists of rejecting anything that does not fit with your worldview

    Well, speaking about such things.. Did you read the T-rex links?

  • Richard Edwards

    When DNA replicates it is a demonstrably imperfect process. Mistakes – mutations – are introduced in a random (but non-uniform) fashion. Over time, these accumulate UNLESS selection eliminates them. When looking at variability in a population or across different species, we therefore see some sites that are not the randomness that would be expected if they had no function – these have the information. Other sites vary in a fashion that is entirely consistent with no selection. To invoke a hidden meaning for them you also have to invoke a hidden role for all the variability. Other contributing evidence is the many laboratory experiments where mutations are deliberately introduced and function assayed. Yes, there could *conceivably* be a hidden function that we are not assaying but this is where the weight and accumulation of evidence comes in. The number of hidden functions and causes becomes preposterous and, at the same time, you have to explain why the random mutations are not accumulating in the random fashion that they appear to despite there being no apparent reason for them not to. You would not operate like this is any other sphere of life. If you roll some dice – or toss some coins to get a 1010111001 pattern to feed into a computer – and the distribution matches the random expectation, why would you assume that something has guided the coin tosses, if only you knew how to decode it?
    I’ve not read the T. rex thing but will. To instantly dismiss it without looking at the actual data would be wrong, though, so it may have to wait a day or two.

  • JohnM

    None of that explains, how you can look at a 4 letter code, and say this is junk and this is information.

    If you roll some dice

    DNA is not a dice. It’s an information language. Please spare me your false analogies.

    or toss some coins to get a 1010111001 pattern to feed into a computer

    That’s standing the thing on it’s head.. No information would arise from tossing a coin.

    Junk in, Junk out.

  • gobbledegook78

    JohnM, 
    I might as well be blunt. You don’t have a clue. You’re just another ignorant bible thumper who bashes science and believes in impossible, ridiculous fairy tales, and like other thumpers you eagerly use and greatly benefit from lots and lots of things that SCIENCE has made available even though you denigrate the science and the scientists behind those things. Your words below are all you needed to say to show that you are completely ignorant of what “evidence” actually is. 

    “Belief in the God of the bible, is nothing like the multi verse theory. There’s plenty of evidence that one can look at.. Such as the moral argument. Such as the evidence for the resurrection of Jesus Christ.
    Our faith, is an evidence based faith, unlike belief in muti-verse theory. That you reject the evidence in favour of God, is your problem, not mine.”

    Those are just some of the lies that you keep telling yourself. There is NO evidence of the existence of the fictional bible character “Jesus Christ” and NO evidence of any “resurrection” or any “God”, and the so-called “God” you believe in is one of the most ridiculous, monstrous, and impossible ones ever conjured up by fearful, superstitious, arrogant, ignorant barbarians. Your so-called “God” isn’t even possible. Multi-verses are possible, but may not exist, and whether they do or don’t has nothing to do with the theory of evolution. 

    The “moral argument”? You’ve got to be joking. You believe in and promote a malicious, vicious, sadistic, ruthless, threatening, destructive, amoral, genocidal, imaginary, three-headed “God” monster and yet you have the nerve to bring up morals? Next time you feel like telling someone to grow up you should be looking at a mirror.

    And if you really mean this…

    “That you reject the evidence in favour of God, is your problem, not mine.”

    …then what are you doing here? If it’s not your problem, then why aren’t you just minding your own fantasies and leaving science alone? You might as well admit that you’re insecure in your “faith” and that your insecurity drives you to argue against science and evolution in the hope of strengthening your so-called faith. If your “faith” is solid and you’re convinced that your “God” is real, then why do you care what science does or doesn’t do, especially in regard to studying and explaining evolution? It’s mostly the ape to man thing, isn’t it? You ‘ain’t no filthy ape’, right? You’re vastly superior to lowly animals, right? You have a ‘god given soul’ and animals don’t, right? You can’t stand the thought that you’re just a descendant of primordial goo and an ape-like critter, right?  You’re specially created and exceptional, right? You’re the ‘image’ of “God” and “God” ‘ain’t no filthy ape’, right? Does that ‘image’ include all the monstrous stuff that is attributed to your “God” in your so-called ‘holy book’?

  • JohnM

    Gobbledegook78 :

    Those are just some of the lies that you keep telling yourself. There is NO evidence of the existence of the fictional bible character “Jesus Christ”…

    Great. Another Christ myth lunatic..

    And if you really mean this….then what are you doing here?

    Ohh.. So only those who agree with your point of view, are welcome here?

    Love the free thinker mentality around here.

    It’s mostly the ape to man thing, isn’t it? You ‘ain’t no filthy ape’, right?

    Ape to man??!?!?

    Don’t you mean common ancestor?

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    “Another Christ myth lunatic”

    Great ad hominem.

  • gobbledegook78

    JohnM, 

    Do you also believe in all the other thousands of gods that people have ever thought up? I hope so because I’d hate to think that you’re an ‘all the other gods that people have ever thought up’ myth lunatic. 

    Whether you’re welcome here or not isn’t the point. By saying “That you reject the evidence in favour of God, is your problem, not mine.” you make it sound as though you don’t care what others accept or reject but it’s obvious that you do care. At least be honest about it. 

    And do you actually believe that deliberately ignoring reality and believing in impossible religious fairy tales makes you a “free thinker”? I’m sure that you’ll disagree with this but bluntly rejecting or being indifferent to imaginary sky daddy monsters and other religious delusions is not being closed minded. You’re the one with the blindered dogma. I just don’t want science to be fettered or destroyed by religious zealots as it works at discovering and explaining what goes on in nature. I realize that scientific research and explanations aren’t perfect or 100% complete for everything in nature but relying on an endeavor that seeks real answers and solutions sure beats the hell out of relying on mind-deadening religious mumbo jumbo. 

    “Don’t you mean common ancestor?”

    You know what I mean. 

  • JohnM

    Jonathan:

    Great ad hominem.

    Oki so it’s perfectly fine to question something that happened around 2000 years ago, for which we have historic evidence of..  But if you question a theory, about something supposedly happened somewhere between 70 million and 4 billions years ago, then you’re at odds with rationality..

    Is that a fair representation of your viewpoint?

  • JohnM

    gobbledegook78 :

    you make it sound as though you don’t care what others accept or reject

    That’s right. At the end of the day, I don’t care what conclusion, other people arrive at.

    I’m sure that you’ll disagree with this but bluntly rejecting or being indifferent to imaginary sky daddy monsters and other religious delusions is not being closed minded.

    And by the sound of you rhetoric, you’re a really open-minded person, huh?

    You know what I mean.

    No, I don’t know what you mean, by “ape to man”. Could you explain it to me?

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    No. my point was labelling such people lunatics as ad hom. I suggest you read Richard Carrier’s “Proving History” where he accounts for such a position using Bayes’ Theorem. He is not a lunatic. And this shows the kneejerk reaction to opposing theories without being willing to engage. i am not a mythicist, I am agnostic. There are shed loads of points that Carrier raises that need to be answered and seemingly cannot.

  • JohnM

    You can’t be serious. Richard Carrier is a know associate the infidels.org garbage website.

    Is that where you get your information from?

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Oh dear. That’s terrible and shows you don’t know what you are talking about. 

    Watch this:
    http://www.youtube.com/watch?v=pX4LvKvIWJw

    And please don’t trash people without having a clue of their pedigree or work. I would also suggest reading his “Not The Impossible Faith” which is a very good book. 

    i would like you to tell me where the problems are with his work on the application of Bayes’ Theorem to historigraphy. 

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Also, you might want to see his superlative essay on the Nativity and Luke:
    http://www.infidels.org/library/modern/richard_carrier/quirinius.html

    It is still the best thing written on it (and even Christian authors like Charles Foster agree).

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Furthermore, it is funny that you trash the Infidel website (with no evidence) after producing two of the worst links known to man in defending your MG position!

  • JohnM

    I guess that settles where you’re getting your information from…

    And please don’t trash people without having a clue of their pedigree or work.

    I love that statement. Especially considering all the ignorant statements, from various posters, about ID in this discussion.

    But no, I’m not unfamiliar with the “work” of Richard Carrier.

  • gobbledegook78

    JohnM said:

    “…for which we have historic evidence of…”

    What “historic evidence” of what that allegedly happened around 2000 years ago? (Cue the bible verses….)

    And John, what makes the “historic evidence” for your religious beliefs any more convincing than the “historic evidence” for all the other religious beliefs of the world, many of which are much older than christianity? I hope you realize that just because many people have believed in various fairy tales for a long time doesn’t mean that any of the fairy tales, including the christian ones, are true. 

    One more question for now:

    Did adam and eve and jesus eat and/or ride dinosaurs and mastodons and were there trilobites, dinosaurs, pterosaurs, plesiosaurs, fishopods, titanotheres, creodont carnivores, 4 toed horses, and saber-toothed cats in the garden of eden and on the ark? 

  • JohnM

    Seriously… Don’t you get it? Richard Carrier is not a serious scholar. Mkay? Most experts within the field, refers to him as “mystic”. And if you want to see none other than Bart Ehrman himself, completely destroy Richard Carries credibility, then look no further than this:

    http://ehrmanblog.org/fuller-reply-to-richard-carrier/

  • Andy_Schueler

    Most experts within the field, refers to him as “mystic”

    It´s “Mythicist” you imbecile. And btw, Carrier is not a mythicist. 

    And if you want to see none other than Bart Ehrman himself, completely destroy Richard Carries credibility, then look no further than this:

    And here is Carrier´s reply:
    http://freethoughtblogs.com/carrier/archives/1151/
    I would be willing to bet that you have read neither Ehrman´s nor Carrier´s arguments in any detail.

  • JohnM

    Lol. Way to take offence, huh?

  • Andy_Schueler

    Lol. Way to take offence, huh?

    I take that as a “yes, I did not actually read either Carrier´s or Ehrman´s arguments in any detail”

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Look, I know a lot more about the Carrier / Ehrman debacle than you. And considering you are getting your info straight from Ehrman, it might do you well to cruise some of the hundreds of essays and posts about that. I rate Ehrman, but his HuffPost article which started it off was shit and Carrier correctly called him out on it. His latest book, by all accounts is his worst. And I love his others.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    Rather than sit here and slag off a scholar, either provide examples of his work which are representative of him and show their weaknesses, or don’t mention him. 

    Simply the fallacy of poisoning the well – deal with the work and not the author.

  • Richard Edwards

    @JohnM. No, junk in + selection = something out. Plus, just because something *can* carry information, it doesn’t mean that it does. Information decays. Entropy. Know about that? You guys normally love to bring it up. Without selection maintaining biological information, it decays. Look up pseudogenes and the C-value paradox. And endogenous retroviruses. Or not. I don’t care anymore. It is clear that not only do you not understand, you have no interest in understanding. (And calling the human genome a “word” would still be horribly wrong, even if it was a bacterium or virus that you were talking about, which is packed with information in comparison.)

  • JohnM

    Richard Edwards:

    No, junk in + selection = something out.

    No, Natural selection, picks between the junk that comes out.

  • Pingback: Evolution is indisputabhttp://www.skepticink.com/nocrossnocrescent/wp-admin/post.php?post=587&action=edit&message=10le: a response to some creationist-ahem-”intelligent design” fallacies | No Cross No Crescent

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce
  • Richard Edwards

    @JohnM, if it was always junk coming out then nothing would adapt, you’d get no resistance (for example) developing in wild and lab experiments of selection would fail. You’d better tell viruses and bacteria that they’re doing it wrong. And yeast. And flies. And every other organism that we have studied how mutation and selection works in the field or laboratory. Perhaps you don’t realise that there is good evidence that a small proportion of new proteins arise from previously non-coding DNA and that even random protein sequences can be functional? (I’m mobile at present but can dig out refs later if anyone wants.)
    Or is evil god out there tinkering with pathogens to make them resistant but doing it in a way that is undetectably different from a process driven by random mutation so as to keep himself hidden?
    (BTW, do you really think that Jesus referring to “evil god” (I don’t think he used that term, did he?) as the “father of all lies” is the same as saying that “evil god” got in and tinkered about with nature, creating probably more stuff than God himself? (If random mutation, evolution by Natural Selection, and Old Earth geology are all “lies”, the work rate of “evil god” is considerably higher than “good god”.) This statement of Jesus is also funny because “good god” is caught telling lies in the opening story of his book and “evil god” is caught telling the poor lied-to humans the truth. Unless you re-intepret the words on the basis of the fact that “evil god” is the father of all lies. But that wouldn’t be circular reasoning at all, would it?)
    Anyway, I am handing on the mantle to the post that Jonathan mentioned. I can still provide those references if wanted and will get back to you about T. rex but that’s my lot.

  • JohnM

    Richard Edwards:

    if it was always junk coming out then nothing would adapt, you’d get no resistance (for example) developing in wild and lab experiments of selection would fail.

    You’re talking about copy-errors, once we have the information. I’m not talking about that. I’m talking about how you get the information, to make copy errors in, in the first place.

  • Richard Edwards

    Perhaps someone else can point out to JohnM that: (1) if he is talking about the origin of the replicating information carrier (whether it be DNA, RNA or something else we don’t know), that’s NOT EVOLUTION but the ORIGIN OF LIFE, which IS A DIFFERENT QUESTION (and if he expressed himself better, this would have been obvious from the outset). Once you have it, “copy errors” can (in theory) do the rest because some of those errors are duplications (either inter- or intra-genomic); (2) A horizontal transfer or even (arguably) intra-genomic transposition is a gain for the recipient genome/chromosome and is not necessarily a “copy error” with respect to the information carried within it because genetic information is highly context-dependent. He can imagine inserting a chunk of binary computer code somewhere else on the hard drive, if he likes. (I think the analogy is a good one in this case, particularly if you have not defragmented your drive for a long time.); (3) As he believes in a Young Earth, he needs to explain why separately created entities look like they have evolved differences through this “copy editing” process – including the majority of variability in the human population. (In other words, why do genetic studies of many difference organisms give coalescent times that are many tens or hundreds of thousands of years older than his Earth, whether using clocks calibrated on fossils OR contemporary mutation rates? And point out that he needs to be very careful about increasing mutation rates to account for it, as there is a definite trade-off between the amount of information a genome can carry and its replication fidelity. In other words, I’d like to see some maths that any proposal can account for (i) diversity, and (ii) would not create a crippling level of deleterious mutations. To keep things simple, he can start with animal mitochondria, as they do not recombine and he presumably believes that all non-clean animals went through a population bottleneck of two individuals at the time of the flood. Or even start with humans and push the two-person bottleneck back to Adam and Eve.)
    I would but (a) I am trying to ween myself off replying to him and (b) I seem to fail to say things in a way that he understands. (I don’t feel too bad about (b) because it appears to be a problem suffered by contemporary science across the board. (a) worries me a little, though. (Jonathan, perhaps you can write a post on why rational people find it so hard not to try to defend/educate about science even when it is clearly a lost cause? It’s not like one more false claim on the internet will make any difference.)

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    JohnM,
    Get lost nut job.

  • http://www.skepticblogs.com/tippling/ Jonathan MS Pearce

    I’ll resurrect an old post that was about this – why do normal people believe stupid things, or something like that.

  • http://pulse.yahoo.com/_NZMJ7JRYKH7WR6YTXJGG3PU65E John Grove

    Christians have got to be the most scientifically illiterate, intellectually dishonest, unbelievably shallow, unusually incurious, abnormally unintelligent, amazingly inarticulate, fantastically uncultured, extraordinarily uneducated and apparently quite proud of all these things.

    I’m John Grove and I approve this message