• Yes, You Must Have a Designer

    I get this on nearly a daily basis from proponents of intelligent design, “The designer doesn’t matter if we can detect design.”

    Sorry, but that’s just wrong. First of all, there has been no case, ever, of an ID proponent detecting design. They claim to “see” design in various aspects of biology, biochemistry, geology, physics, and astronomy. But what they cannot do is detect design in a controlled experiment. They have never successfully (or attempted as far as I am aware) determined design or non-design in anything of known providence without being aware of the design or non-design first.

    This is exactly the same kind of conditions that are required of the James Randi Paranormal Challenge. While ID proponents claim to have detected design in living things, what they have never shown is that living things are actually designed.

    Consider that if you and I were sitting in front of a safe. Neither of us had ever seen it before and neither of us knew the combination. If I insisted that the secret formula of Coca-cola was in the safe, then you would be right in questioning me. Neither of us have any way to verify it and you know I really don’t have a clue what’s in the safe. That’s ID in a nutshell.

    Until an ID proponent can successfully determine design, then we’re left with the designer.

    Here’s the thing, Meyer (for example) is convinced that the body plans of the majority of the species alive today originated in the Cambrian Explosion some 540 million years ago. I believe that most ID proponents would say that the designer is also responsible for the creation of life between 3.5 and 2.7 billion years ago. And, as we see here, Meyer posits the designer with credit for the development of echolocation in bats (roughly 50 mya) and whales (prior to 28 mya).

    So, the designer (always mentioned as one), has existed for no fewer than 500 million years and most more than 2.7 billion years and quite possible longer than 3.5 billion years.

    Even assuming that the designer is a species of (to paraphrase Michael Behe) alien cell biologists, their species has been around longer than every thing on Earth and even billions of years ago, they had sufficient technology to travel to Earth and modify genomes in such a way as to leave traces that deliberately echo evolutionary patterns.

    Indeed, some ID proponents have claimed that the designer only acted once, but left all the information needed for ALL  living things that ever where or will be, in the genome of those first organisms. This is process known as front-loading. This is clearly impossible, since the genome of every living thing on the planet is different and those first organisms genome surely wasn’t large enough to carry every bit of information needed for everything that would come later.

    ID Proponents say that we know design because we see it all the time. We see events and products that are the product of intelligence. That much is correct. We do see products, devices, technology, and all kinds of intelligently designed events that wouldn’t exist in nature without an intelligence.

    But every single one of those things have one important common factor. We know the intelligence that is involved. We understand how that intelligence works. We know what capabilities that intelligence has. We know all this, because it’s us.

    Consider the following. Click on the picture to go to the full information from the Brooklyn Museum.

    Brooklyn Museum: Bow, Bow Case, Arrows and Quiver

     

    This is obviously something intelligently designed. It would be very, vastly, improbable that this combination of products from a variety of animal and mineral sources were to randomly come together to produce this bow, quiver, and arrows.* Therefore an intelligence must have created it.

    Given that we know of only one intelligence that uses tools to make other tools (though more recent studies show this may not be correct), we can safely assume that this was designed and constructed by a human. But that’s not all. Because of the area in which is was found, we know that the human constructing it was not Eskimo, African, Asian, Australian, European, and most probably not South American. We know that modern humans (by which I mean in the last hundred years) did not construct it as well. We know that elk, horses, buffalo, and ducks were in the area at the time of construction.

    We know all that, from just looking at the device.  In case you’re curious, it is believed to be from either the Sioux, Nakota, or Yankton cultures.

    Now look at this bow and arrow set.

    Carbon Fiber Compound Bow via http://www.hoyt.com/
    Carbon Fiber Compound Bow
    via http://www.hoyt.com/

    We know that this bow was not made prior to 1958, when the carbon fiber process was first developed. We know that the intelligent designers of this bow have extremely advanced technology. Look at the three tube system and the pulley design. This is a complex feat of engineering and construction. Again, we know it could not have been developed prior to 1958 and it probably wasn’t developed before the extensive use of computer-assisted-design. We know that the designer and builder of this device has mastered some impressive knowledge of chemistry and physics to build this device. Something else that cannot appear in nature.

    Now, when intelligent design proponents talk about how looking for intelligent causes is used in today’s world, they are correct. SETI (Search for ExtraTerrestrial Life) is looking for design. Specifically it is looking for radio signal modulations that cannot occur in nature and, like the carbon-fiber bow, can only be developed by a technological species.

    Likewise forensics and anthropology are looking at a very specific intelligence with known features, abilities, and skills. Native Americans in the 1800s could not have constructed the carbon-fiber bow and Eskimos probably couldn’t have constructed the elk horn bow**.

    Meanwhile, the ID proponents are saying that there is an intelligent designer that has lived or had a program running for well over 2.7 billion years, had levels of technology that we’ve barely begun to explore, and a willingness to meddle. Of course, that begs the question of where that intelligence came from.

    But, what can the ID proponents tell us about the designer by looking at its designs? I’ve said more, in the preceding paragraph, about the notional designer than any ID proponent I’ve ever read.

    Of course, if you actually read everything the various ID proponents write, then it is obvious that the designer is god. In general, it is some variation on the Judeo-Christian god. Sadly, that brings up many, many more problems than it solves.

    What are we left with?

    Sadly, not much. We have unconfirmed design. We have no reliable method for detecting design. No method for detecting design has ever actually been tested in a robust, scientific manner (as I have challenged any number of ID proponents over the last two decades).

    We also have no designer. We have no evidence of any designer capable of accomplishing the things claimed of it, including: surviving for billions of years, performing changes to DNA that mesh perfectly with what we would expect to see via evolution, successfully predicting the future state of DNA millions of years down the road, not to mention getting to Earth, not to mention who designed the designer, all for an unknown purpose.

    Finally, and this is just me kicking the corpse because it pissed me off. No ID proponent has ever used ID principles to predict anything. That’s a necessary feature of a theory… predictive power.

    Until ID proponents deal with these issues (and in the past 18 years, they haven’t even made the attempt), ID is useless.

    ________________________
    * I need to remind everyone that all of our proteins and DNA and the like is also non-random, expect that it is because of evolution as there is no evidence for design.

    ** I’ll leave it to an anthropologist to tackle that question, but while it is possible for them to construct the bow, I doubt it would last very long in harsh conditions.

     

    Category: CreationismScienceSkepticism

    Tags:

    Article by: Smilodon's Retreat

    • As John Wilkins, the stubornly antipodian philosopher of science has said:

      ID requires a designer who can visualise all possible combinations of chemistry over billions of years. If that *isn’t* a supernatural designer, I’ll eat my epistemological hat!

    • Christine Janis

      No
      ID proponent has ever used ID principles to predict anything. – See
      more at:
      http://www.skepticink.com/smilodonsretreat/2014/05/19/yes-you-must-have-a-designer/#sthash.Nc9wzA3T.dpuf
      No
      ID proponent has ever used ID principles to predict anything. – See
      more at:
      http://www.skepticink.com/smilodonsretreat/2014/05/19/yes-you-must-have-a-designer/#sthash.Nc9wzA3T.dpuf

    • Christine Janis

      Same again — I try and cut and paste something and it does this to me! OK, I was going to jump the gun on someone claiming that, yes ID *does* predict things, it predicted that not all “junk” DNA was “junk”. Sigh.

      • SmilodonsRetreat

        I was hoping someone would mention that. 🙂

        First, what ID principle was used in making this “prediction”.

        Second, the earliest reference I can find for this was Michael Behe in the early 90s. Of course, Gould was saying much the same thing in the late 70s, so not much of a prediction there.

        Third, there is still junk DNA. ERVs don’t actually do anything at all. Just “junk” for some definition of junk.

        BTW: Are you using a Mac?

        • Christine Janis

          Yes, but I’ve learned my lesson now not to try and cut and paste from your text!

        • Historically, what happened was that NO “evolutionist” ever claimed that junk DNA was a prediction of evolutionary theory. After all, if natural selection worked against expensive-to-construct features, like eyes in cave fish, there was no Darwinian reason for there to be junk DNA, if it was expensive to construct and maintain. An editor/columnist at Scientific American (who’s name escapes me), and who may or have may not have been fired for being a YEC, said in the early ’90s that creationism predicticted that there would be no junk DNA. Quite independently, and with no reference to that person, some scientists and science supporters, after junk DNA had been well established, pointed out, in opposition to ID, that junk DNA was more consistent with evolution than ID.

          In short, it was never taken as a scientific argument for Darwinian evolution, only as a (frankly rhetorical) argument against ID. The Discovery [sic] Institute eventually found out about the editor/columnist’s statement and blew it up into an alleged “prediction” of ID and have been flogging any discovery of some discovery of a funtion of junk DNA as “evidence” for ID. It is nothing more than a bait and switch … which, of course, is the sum and substance of ID.

        • Gus

          Evolution ultimate lie! where are fossils? where are genes evidence? you are fooling yourself!

          • SmilodonsRetreat

            Hi Gus. Instead of saying things that are stupid like that, perhaps you should read my blog posts. There, you will find your fossils, your genes, and find that you are being lied to.

          • Nerdsamwich

            Dude, you’re not even trying any more.

            • Gus

              You. Do. Not. Know. God. Nerd. You.. Simply. Do. Not. Know. Him. At. All.

            • Darrah Densmore

              If “knowing God” turns one into a delusional idiot such as yourself, I can think of nothing I’d less rather know.

            • Gus M.

              Shut. Up. Not. Knower. Of. God.

            • SmilodonsRetreat

              Gus,

              1) You don’t get to tell people on my blog to shut up.
              2) Saying the same thing over and over doesn’t make it true.
              3) Adults have conversations in which questions are asked and answered, you are not behaving like an adult.
              4) But please keep expressing yourself, you remain one of the best arguments for atheism I’ve ever seen.

            • Gus M.

              How could random motions make molecules for life? How could this be? God. Is. The. Answer.

            • SmilodonsRetreat

              Sigh. It is better to be thought an idiot, than to open one’s mouth and remove all doubt.

              1) For god to be an answer to anything, then he would have to be shown to exist. He hasn’t. This is exactly the same as saying the invisible space-going pegasi are towing all the planets and asteroids around the sun. Yes, it’s an answer. It’s a stupid-ass answer, but it’s an answer.

              2) You really, really, really should read about some of the actual research in origins of life. For example, molecules that were previously though to only come from life have been found inside both comets and nebula.

              Random mixing of atoms and compounds, with a little energy from the sun, lightening, and volcanic vents can produce many of the chemicals for life as Miller/Uery showed OVER 60 YEARS AGO.

              There is nothing worse than some one who prefers to be ignorant, proudly proclaims his ignorance, and demands that everyone should be as ignorant as he is.

            • Gus M.

              Give me citations then. links. i dont believe you.

            • SmilodonsRetreat

              Szostak, J. W. Origins of life: Systems chemistry on early Earth. Nature 459, 171–2 (2009)

              Michaelian, K. Thermodynamic origin of life. (2009). at

              Michaelian, K. Homochirality through photon-induced melting of RNA/DNA: the thermodynamic dissipation theory of the origin of life. (2010). at

              Attwater, J., Wochner, A., Pinheiro, V. B., Coulson, A. & Holliger, P. Ice as a protocellular medium for RNA replication.Nature communications 1, 76 (2010).

              Powner, M. W., Gerland, B. & Sutherland, J. D. Synthesis of activated pyrimidine ribonucleotides in prebiotically plausible conditions. Nature 459, 239–42 (2009).

              Costanzo, G., Pino, S., Ciciriello, F. & Di Mauro, E. Generation of long RNA chains in water. The Journal of biological chemistry284, 33206–16 (2009)

              Ghosh, I. & Chmielewski, J. Peptide self-assembly as a model of proteins in the pre-genomic world. Current opinion in chemical biology 8, 640–4 (2004).

              Lincoln, T. A. & Joyce, G. F. Self-sustained replication of an RNA enzyme. Science (New York, N.Y.) 323, 1229–32 (2009).

              Joyce, G. F. Evolution in an RNA world. (2009). at

              Springsteen, G. & Joyce, G. F. Selective derivatization and sequestration of ribose from a prebiotic mix. Journal of the American Chemical Society 126, 9578–83 (2004).

              Here’s on from 1974: http://link.springer.com/article/10.1007/BF00927013

              Ciesla, F. & Sandford, S. Organic synthesis via irradiation and warming of ice grains in the solar nebula. Science (New York, N.Y.) 336, 452–4 (2012)

              Anders, E., Hayatsu, R. & Studier, M. Organic Compounds in Meteorites: They may have formed in the solar nebula, by catalytic reactions of carbon monoxide, hydrogen, and ammonia. Science (New York, N.Y.) 182, 781–90 (1973).

              I could go on and on… some of this is from the early 70s. So YOU are WAY behind the times.

            • Gus M.

              your just scared of gos love.

            • SmilodonsRetreat

              blah blah blah…

            • RexTugwell

              Smiley, Gus M. is obviously a troll yanking your chain. Probably a Darwinist’s lame attempt to make creationists look bad. Why you can’t see that is beyond me. NO ONE writes like Gus M. does. Not even people whose second language is English.

            • SmilodonsRetreat

              You must not get around much in the actual creationist circles (including ID). Gus is a literature professor compared to some. You need to meet a guy named Robert Byers…

            • RexTugwell

              I’m familiar with Robert Byers. He doesn’t write like Gus M. does. But go ahead and indulge Gus. He’s probably having a great time at your expense. I know how he feels.

            • SmilodonsRetreat

              Yeah, I know. However, I still tend to see the good in people, regardless of how ignorant, childless or jerks they are.

            • Gus M.

              why do you hate HIM.

            • SmilodonsRetreat

              You can’t hate something that doesn’t exist.

              However, I do really dislike most of the hypocrites who claim to follow the rules of the Bible.

            • Gus M.

              He does exist. explain to me how motions random lead to us. Not. Knower. OF. God.

            • SmilodonsRetreat

              1) I’ve provided the references to show that random movements of atoms can result in organic compounds.

              2) Evolution (which isn’t totally random) provides a framework for understanding how the diversity of life has arisen.

              The fact that you seem to not understand this is pretty telling. These are the basic concepts of science.

            • Darrah Densmore

              Your god is imaginary and you write as though you’re brain-damaged. Good luck with that.

            • Doc Bill

              Gus-the-Troll. Tell. Darrah. Shut. Up.
              Not. Tell. Doc. Shut. Up.
              Respect. Doc.

              Gus, when you get to high school you’ll probably take chemistry in which you will learn that ALL chemical reactions are the result of random motions of atoms. Thus, your “argument,” pitiful, childish and unoriginal as it is, is moot. If you work hard (I realize high school can be traumatic!) and continue studying chemistry, then maybe, just maybe, you’ll learn about polymerization occurring naturally on catalytic substrates.

              No, be a good little Gus, find yourself a dictionary and look up all those big words Doc used, and especially that little, but important word, moot.

            • Gus M.

              how can you prove god had no hand in them? You. Do. Not. Know. Him.

            • Doc Bill

              OMG, Gus, you’re right! Protein doesn’t just denature itself!! Every time I boil an egg it’s the Hand of God in my very own kitchen!!! Praise the Lord and pass the salt!!!!

            • Gus M.

              You are showing all those who care, whether here or in the air that YOU, Doc Bill, Do. Not. Know. God.

            • Tim Tian

              Hi Gus, haven’t seen you in a while. I see you’re back to half-speaking in proper sentences again. Now, I’m kinda getting bored of this so how about you come to my house and I give you a nice little lecture on using your brain? (If you have one, that is)

            • Gus M.

              As if I care.

              You.

              Do.

              Not.

              Know.

              God.

            • Tim Tian

              I’m sure your god would appreciate you destroying his reputation.

    • No method for detecting design has ever actually been tested in a robust, scientific manner (as I have challenged any number of ID proponents over the last two decades).

      Hypothetically speaking, what would such a test look like?

      • SmilodonsRetreat

        I have suggested (several times) comparing a DNA sequence or protein sequence that is known to be designed (because a human designed it) and a totally random sequence of a similar length.

        In this way, design principles could at least be compared between totally random and totally designed.

        Now, ID proponents have said that this doesn’t work because there must also be “specification”. And one is left to wonder how that is quantified. All of the ID proponents I’ve read about this (including some commentors on this blog) have said that, for all practical purposes, specification is “it looks designed for a purpose”.

        What these proponents completely fail to realize is that evolution produces results that are extremely similar (in many cases superior) to designed systems. So, the ID proponents really must talk about the actual intelligence, because evolution is shown to be a designer of some note, including novel systems and irreducibly complex systems.

        So, back to your question, I would propose that if an ID proponent could describe a method, usable by anyone, by which they could correctly choose between designed and random at a better than 50% rate (although, it should be expected to be closer to 90%).

        Then we could compare systems that were designed (again, by humans) and evolved. If they could consistently determine the difference between evolved and designed systems at that same rate (again, using some presently non-existent ID principles), then I would be willing to admit that there is something to ID principles.

        Not only has no ever even attempted this, I have posited to several mathematicians that such a test is fundamentally impossible and they have tentatively agreed with me. Without a rigorous mathematical proof, there’s no way to be sure, but it seems highly unlikely.

        Through statistical measurement of large groups of numbers, there might be a way to tell random strings from designed strings, but that’s not an ID principle.

        • You seemed to break up your answer so let me rephrase what I take your answer to be:

          (1) We design some DNA or protein sequences.

          (2) We randomly construct some DNA and protein sequences.

          (3) An ID proponent proposes a method to determine whether a DNA or protein sequence is designed or not.

          (4) We apply the method from 3 to the DNA or protein sequences created in 1 and 2 and determine the accuracy of the method.

          (5) We apply the method from 3 to naturally occurring DNA or protein sequences (e.g., from humans, cats, insects, plants, etc.).

          (6) The more often the method identifies naturally occurring DNA or protein sequences as designed the stronger the case for ID becomes.

          Does that sound accurate?

          But you then state that such a test may be impossible. If it is truly impossible then doesn’t that entail there is no (mathematical) test that can decide between ID and evolution?

          • SmilodonsRetreat

            If you just consider the sequences (and you can write those in text for easier calculation), then it may be possible (using statistics) to judge between purely random and designed.

            However, evolved is a form of designed, just without an intelligence involved in the process.

            So, unless the ID proponents have something up their sleeve that no one else has ever heard of, then I think it may be impossible to tell the difference between designed by an intelligence and designed by evolution.

            At least in nothing but pure sequences. If you consider the organism or entire genome, then I would think that we would see things that are more likely the results of evolution than design. For example, extraneous material (ERVs for example), copied sequences from closely related organisms perhaps with minor changes (opsins for example). That’s not a definitive list and many ID proponents claim these things as evidence of design (code reuse and “padding”).

            Of course, that is just a just-so story to explain what is actually seen in terms that can be justified by ID. They have yet to even propose a test… I’ve done more work in ID than any of ID proponents in that I’ve actually proposed a possible test of ID principles.

            • I think you are correct that we could statistically distinguish between a designed sequence and a truly random sequence. If that’s the case, then I suspect your test would result in ID proponents claiming naturally occurring sequences are not random and therefore are intelligently designed and evolution proponents claiming naturally occurring sequences are designed by a non-intelligent process. The test would not end the debate.

            • SmilodonsRetreat

              Yeah, there would be no end to the debate. That assumes that both sides are actually looking for evidence and understand when that evidence is found.

              I have had an ID proponent tell me that everything down to the random snow on a TV screen from the cosmic background radiation has been designed. Which means that design as a concept is useless, but it was purely to promote their deity.

            • Doc Bill

              Regardless of a test, ID proponents face a more fundamental problem – what is the definition of design?

              For example, if I take a bucket of paint and throw it on my garage floor the resulting “art” is by design. I did it with intent for a purpose. Lest you laugh out loud that thought experiment is no different from Behe’s Mt. Rushmore argument for design.

              Continuing, if in another garage a shelf fails allowing a bucket of paint to spill on the garage floor, by what metric could an objective observer determine which paint spill was accidental and which was designed?

              To save you some pain the answer is “there is no objective metric for design.” We all know that which is why ID is such a farce.

              Even the main proponents when pushed have fallen back to having to know something about the designer. Nothing more than old fashioned creationism with a bunch of fancy sounding words that even the ID proponents don’t understand.

            • I’m not sure the definition of design is much of a problem. The problem is, rather, how to determine whether a specific entity is designed. But this is not a problem just for ID proponents. It’s a problem for all of us because we all believe some things are designed.

            • SmilodonsRetreat

              Well, I am quite confident that the peculiar mixture of shaped wood, hardened clay, extruded plastics, and various metal alloy fasteners that make up my house was designed. Like I mentioned in the OP, I can point to the designer, I know the purpose for which it was designed, and I know it is completely within the capabilities of a specific intelligence to design and construct.

              However, houses do not self-reproduce. The entire blueprint for a house is not contained in every single minuscule part in the house.

              So, while we can safely talk about designed things that are not living, it is much more difficult to talk about design in living things… or even whether such design exists. This is one of the central problems with ID proponents. They have assumed that such design of living things exist without even being able to define “design”.

              I think it’s Doc Bill who asks ID proponents to name a living thing (or part) that is NOT designed.

              I’ve asked many of them for the procedure for determining design. Never gotten a decent answer. For example, If I presented someone with a pile of appearingly random numbers, then presented them with a detailed series of mathematical steps, they could, eventually decode the encryption and read what I wrote, then encrypted. I could give those numbers and process to anyone (with appropriate mathematical ability) and they could perform the same process.

              ID has no process like this. Even Behe of irreducible complexity fame, keeps changing what is ‘designed’. At first it was the entire blood clotting system, then it was certain parts of the blood clotting system, but not all of it (after Ken Miller showed him that certain organisms don’t have all the parts). So, the ID proponents don’t even know what’s designed.

              I can sum up the entire design process in three words. “It looks designed.” That’s it. That is all ID proponents have. Sadly, they generally either have no idea about the evolutionary history and biochemistry of what they are looking at or (as in the case of Meyer) deliberately misinform their readers about the evolutionary history and biochemistry of the system.

            • Yes, if we observe a designer designing X we know X was designed. At the same time, if we don’t observe a designer designing Y we don’t know that Y is not designed.

              But I doubt many people would not infer that some things were designed even if they never observed the designer. We all have some notion of what is natural and what is artificial, even if we don’t have a quantitative method to determine such things.

              You appear to allude to this in your SETI example. Allegedly, a certain radio signal modulation cannot occur in nature. Of course, the SETI skeptic could merely retort that just because we don’t know how the signal could occur naturally does not mean it is not natural. There may be a level of uncertainty we have to live with. That ID proponents don’t have a quantitative method doesn’t make them different than the rest of us (in other areas of life).

              From my layman perspective, it seems that evolution is true, broadly speaking, but we don’t know if or when a designer created or tinkered with life. Nonetheless, thinking about how to distinguish the natural from the artificial seems worthwhile in its own right.

            • SmilodonsRetreat

              Until there is any evidence, then it’s a moot point. We have a valid explanation that covers the development of the variety of life on this planet and no designer is required.

              It’s up to the ID proponents to defend their notions, attacking evolution isn’t sufficient.

            • I fail to see how the claim that “no designer is required” is supported by much more evidence than the claim “a designer is required”. It’s based on your intuition regarding what is natural (as opposed to artificial). Why not just say evolution is a solid theory regardless of whether a designer was or was not involved in the process?

            • SmilodonsRetreat

              It very much depends on “designer”. What is the designer? Is it evolution? Then I agree with you.

              Is it a supernatural entity? Then there is no evidence to support it.

              Is it an alien? Then there is no evidence to support it.

            • Yes, evolution would be a designer at one level of explanation. But beyond that, my point is we can’t answer such questions and thus should make no allusion to them, one way or the other, in our scientific theories.

            • SmilodonsRetreat

              I agree.

              However, I’m not talking as a scientific theory, I’m talking about a practical matter.

              Sadly, while I think you and I agree here. The proponents of ID do not agree. And I’ve been fighting against their pseudoscience for almost two decades now. They don’t have a problem with using god of the gaps arguments, misdirection, misuse of science terms, quotemining scientists, and flat out lying.

              Sadly, this means that 90% of what I talk about is tinged with the anti-creationist mentality.

            • I understand. I have no interest in misrepresenting science but find the philosophical questions intriguing. I’ll leave it there.

            • Gus

              You. don.t know. god. your going to hell.

            • Nerdsamwich

              You don’t know English. Seriously, this shit is just getting sad. Try harder, of head off to more fertile waters.

            • Gus

              Guess what? God. Why guess? You. Do. Not. Know. HIM. You afre evil!

            • SmilodonsRetreat

              This is actually kind of interesting. So, what you are saying is that people who are not Christians are automatically evil. Do you also contend that people who are Christians are automatically good?

            • Gus M.

              Statements like that show me that you, smilodon….do. Not. Know. God.

            • SmilodonsRetreat

              Of course, I don’t. Because god is a myth.

              But you didn’t answer my question. I’m really curious if you are actually as deranged as you appear to be.

              But please keep going. People like you are the best advertisement for the ridiculousness of religion.

            • Gus M.

              Ridiculous you say? Someone does Not. Know. God. To. Day.

              He. Is. Forever.

              He. is. Pure. ACT.

              Do.
              Not.
              Know.
              HIM.

              Evil.

              Random. Motions. Do. Not. Make. lifes.

            • SmilodonsRetreat

              So you either can’t answer my question or won’t answer my question. Which is it?

            • Gus M.

              God. Is. Self. Evident.

            • SmilodonsRetreat

              Only if one is preconditioned by society and culture to accept it.

              Allah is self-evident… to the religious in the Middle East and many, many cultures throughout the world (including the US).

              Para-Brahman is self evident… to a believer in Hindu.

              Coyote is self-evident… to a Native American.

              The evidence for all of them is the same. Non-existent.

              Again, you refuse to answer my question. Why is that? because you know it’s a trap and your faith is already so weak, you don’t dare expose it to reason?

            • Doc Bill

              Reminds. Me. Of. Daleks!

              Ex. Term. In. Ate!
              Ex. Term. In. Ate!

              Same principle, actually. OMG, does that mean that god works for the BBC?

            • Gus M.

              You. Do. Not. Know. Anthing.

            • Nerdsamwich

              Yeah, I do. The deadbeat SOB owes me $200 from poker last Wednesday. He told me you had it, which I believed, on account of you know him so well. So pay up, or admit that You. Do. Not. Know. God.

            • Doc Bill

              Not so fast with all this “tinkering.” We’re talking chemistry, here, not framing a door correctly. There are perfectly valid, reasonable and laboratory reproducible spontaneous chemical reactions that produce much of the components we now see in cellular life: self-forming vacuoles, hydrophobic/hydrophilic molecular transfers, cyclical reactions and so forth. There’s a vast amount of research on the subject but one needs to know a great deal of chemistry to understand it. Clearly, the general public is in no position to appreciate this literature which plays into the hands of the ID scammers who can wave their hands Behe-style and claim, “not sufficient.”

              Remember, when we talk about multicellular life, mainly us critters, we are talking about only 600 million years of evolution. When we talk about single celled life, algae, bacteria and that sort, we are talking about FIVE TIMES or 3 BILLION years of evolution. That’s a lot of sloshing around in the ocean, getting jacked by thermal vents, and bombarded by energy from all directions.

              As a chemist this is all very reasonable and plausible to me. I was horrible at organic synthesis and I made all sorts of stuff by accident. Weird stuff happens all by itself. Don’t get me started on zeolite catalysts!

              What the ID folks propose, and especially the odious Meyer, is that the Designer stepped in around 600 Mya and “tinkered” around but by that time it’s not reasonable at all to use the word “tinker.” Meyer is proposing that entire genomes were changed to enable new “body” plans, but that would involve changing everything, not just the critter but what the critter ate, how it was decomposed, how it interacted with other critters, how they affected the environment – in short, the Tinker would have to CHANGE EVERYTHING, all at once.

              Scientific analysis of the same era, however, finds no problem with normal evolution proceeding at its normal pace under the conditions of the time. In short, Designer Tinker not required. The chemistry and biology developed by the preceding 3 billion years was more than adequate to do the job.

              Where the ID scammers become quite annoying, as Meyer did in his interview with Charles Marshall, is when they whine “but you don’t know exactly how it all came about.”

              No, the royal we don’t. However, you can’t tell me how I got to Austin this morning. Did I drive, take a taxi, fly, bicycle? By which route did I come, Hwy 290 or Hwy 71? All you know is that I’m in Austin and it’s feasible for me to do that by a variety of means. Does the exact one matter? I think not.

            • SmilodonsRetreat

              If you’re in Austin and have some spare time, let me know. I live not too far from there.

            • Doc Bill

              Back in Houston, now, but your people should get with my people and arrange a meet!

            • Void Walker

              Nicely put.

            • Doc Bill

              I disagree. The definition of design is the fundamental problem with the ID scam. Their entire schtick is that “design” has “function” and “purpose.” (It would be more clear if they only said that design needed a porpoise, but I digress.) To recognize function and intent you need to know something about the designer. They are not intrinsic qualities.

              On the bright side for the not so bright ID scammers, relying on an undefined, warm and fuzzy term like “design,” they can get away with picking and choosing at their whim what they want to be designed or not.

            • The definition of design is the fundamental problem with the ID scam. Their entire schtick is that “design” has “function” and “purpose” . . . To recognize function and intent you need to know something about the designer. They are not intrinsic qualities.

              I think we can all agree that the eye, for example, has sight as its function. SETI seems to think that we can know that a radio signal is evidence for a designer even if we know nothing about the designer or the purpose of the radio signal. Examples like this indicate that we do not need to know anything about the designer in order to recognize function, purpose, and design.

              On the bright side for the not so bright ID scammers, relying on an undefined, warm and fuzzy term like “design,” they can get away with picking and choosing at their whim what they want to be designed or not.

              Does the same criticism apply to SETI? Or, suppose we had you explore another planet. You might classify some objects you saw as natural and some as artifacts (even if you saw no life in your exploration). Would your classifications be based on a whim or not?

            • SmilodonsRetreat

              I disagree that we would know nothing about the designer of a SETI signal. We would know that they have a minimum technological level. We know that they understand several important aspects of physics.

              Unlike the purported “intelligent designer” about which we know nothing and are specifically forbidden to ask about.

            • The skeptic can counter that you don’t know the signal is not produced by a natural process unknown to you. You are assuming a designer with certain characteristics to explain a gap in your knowledge.

              This is analogous to someone saying the first lifeform was created by an intelligent designer who understood important aspects of biology.

            • SmilodonsRetreat

              It’s a pretty fundamental rule of physics. The types of signals that SETI is looking for is not possible for natural sources to produce.

              If there is a “gap” in our knowledge of physics that suggests these types of signals can be produced by natural sources, then everything we know about radio, radar, microwaves, etc is fundamentally flawed and that every such system in existence that directly affects human safety (radars, microwaves, even radio towers, cell phones, etc) will have to be stopped until the understanding is fixed to stop interference from these purported “natural sources”.

              This has roughly the same chance of happening as evolution being totally discarded. Which is essentially none.

              If a SETI signal was received (and verified), then we would look for patterns in the signal that indicate design (repeating on a rotational cycle and/or yearly cycle of the source, for example). We wouldn’t just see that signal and say “Aliens!” Although, based on our current knowledge of physics it would be a good bet.

              That’s the thing, science is so, so much more than most people realize. That stuff that they teach in high school and freshman levels of college is so basic that it is basically unusable in any serious discussion on the subject.

              I find it so frustrating to deal with creationists who come up and say, I’ve taken biology and this 8th grade algebra formula and my high school bio text confirm that evolution can’t happen. I mean, really, if it was that easy, then surely the thousands of scientists with graduate degrees in biology, physics, math, statistics, and computer science would have figured it out long before some guy who lives on a country road just outside Scranton.

              Let me give you an example. In most high school biology texts, they say that there is evidence for common descent and they spend a paragraph or two on fossils, embryology, and (maybe) molecular biology. But there are some 29 unique fields of research that all confirm that conclusion. And each of those 29 areas have thousands, if not millions of pieces of evidence that support those claims.

              The point behind all this is that if SETI found a signal and announced “Aliens!”, then they would probably be ridiculed. It would take years of concerted effort by dozens of radio telescopes and hundreds of scientists and mathematicians to verify that kind of signal. And they would look, in detail, for ANY explanation that could conceivably produce such a signal and THEN they would work out ways to statistically compare the signal to what was expected by these other explanations.

              This is how science works.

              It’s not “OMG, we got a signal. Therefore aliens.” It’s “We got a signal and spent a couple of years analyzing it with teams of researchers all over the world. Possible sources of the signal are x, y, z and we’ve eliminated those because of a, b, c. Indicators r,s, and t suggest that this signal is not natural because of e, f, and g. Therefore, we tentatively think this is a good candidate for evidence of a non-natural signal.”

              See the difference? Now, what do ID proponents do?

              “OMG, scientists can’t explain the immune system, therefore a designer.”

              While scientists write dozens of papers and books detailing various aspects of the immune system, how they relate to other organisms, how the DNA fits into a phylogetic tree (which, BTW, is the same phylogentic tree produced by other sections of DNA) that also happens to match the fossil record… etc, etc, etc.

            • Your disagreement with ID proponents seems to be over their failure to acknowledge or understand certain facts. If there were no natural explanations for the immune system (to use your example), and all conceivable natural explanations had been eliminated, then it seems you would be open to at least tentatively accept a design hypothesis. It seems an agreement between you and some ID proponents regarding proper method could be reached (but you hold that they are not following the method correctly because they are not eliminating natural explanations).

            • SmilodonsRetreat

              NO NO NO!

              I would not be open to the design hypothesis UNTIL THERE IS EVIDENCE that the design hypothesis actually works. This is the exact same tactic that creationists (including ID proponents) always use.

              “If we defeat evolution, then design wins be default.”

              That is wrong, wrong, wrong. If evolution was never though of by Darwin. If nothing in the fossil record, genetics, molecular biology or anything else suggested common descent. If every organism on the planet had unique DNA. It still wouldn’t be evidence FOR intelligent design.

              Only positive supporting evidence for intelligent design can work. There isn’t any.

              The ID proponents, including Axe and what’s her name. Are doing science, but even the science that they do doesn’t support ID. Indeed, Gauger (that’s her name) ran an experiment, but couldn’t use the results because evolution happened in her own petri dishes and screwed up her research.

              Back to what Doc Bill was saying. What is an indicator of design? What values indicate design? Why? Everything has to be objective and apparent to everyone, not just Christians.

            • In your SETI example you did not require that it works. You ruled out natural sources of the signal and then concluded that it might be from an artificial source for some reasons.

              And my hypothetical scenario did not involve solely evolution being eliminated, but all conceivable natural explanations being eliminated. But you are correct that I should have included some reasons for the design hypothesis.

              An argument of the following form is valid:

              (1) X is natural or an artifact.
              (2) X is not natural.
              (3) X is an artifact.

              As to your questions, I don’t think there is a quantitative answer to detect design (in general). We have an imperfect understanding of what is natural and what is an artifact. If we come across new objects (such as when exploring a new planet that we don’t know is inhabited or not) we will attempt to classify the objects in light of our background knowledge.

              Suppose we took someone from a primitive civilization that knew nothing of our modern technology and showed them modern technological objects. Without any quantitative method I’m sure he could identify these things as artifacts. Why? Because he would surmise they don’t occur in nature but an intelligence would be capable of creating it. He, like all of us, could make mistakes.

            • SmilodonsRetreat

              That is only a truly logical statement IF proposition 1 is true. That is it is truly a dual choice. Yes, you can only be bald or not bald.

              However, there can be multiple explanations for the diversity of life. Think of it like this. My dinner was either noodles or vegetables. If it was not noodles, then it was vegetables. That is not true. If it was not noodles, then there are still a huge variety of things my dinner was that are not vegetables.

              Regardless, until there is positive supporting evidence, even if it is the last possible option, we still can’t say “design” about living things. We can’t even say it’s probable (like we could with SETI). There’s literally NOTHING.

              You can play word and logic games all you like. There is still no supporting evidence for ID.

            • Doc Bill

              I don’t agree that the eye has sight as its function. The eye knows nothing about sight. It’s a housing for photochemical receptors. The light spot on a flatworm functions as perfectly for that organism as our eye does for us.

              Jayman is attaching a psychological interpretation to a physical process. And why the eye, the creationists favorite toy? Why not fingerprints? What’s the function and purpose of little folds of skin on our fingers or on my cat’s nose?

              I think the great philosopher Dr. William Cosby said it best when asked “why is there air?” His answer, “to fill up volleyballs with.”

              And, no, I reject the application of my ID scammers criticism to SETI. There is a functional specification available that describes the search pattern, methods and criteria for “interesting signals” that’s totally objective. You can measure the signals, their frequency, duration, intensity, source and all sorts of things. If you have a better idea for criteria you can propose it. The classifications are certainly not based on a whim, but they are a product of our collective psychology, how we perceive and interpret the world and on our best understanding of the difference between natural and human-generated radio communications. Sure, aliens on Alpha Centuri could be broadcasting episodes of “I Love Luciblorp9x” on a band we’re not monitoring using an encoding we fail to detect and we’d never know it.

              ID has NO criteria for design other than “it looks designed.” Well, as a Seti @ Home processor for many years I saw lots and lots of patterns that looked designed, alas, the computer algorithm disagreed with me.

            • I’m not claiming the eye knows about sight. A physical process can still have a function. For example, the Merriam Webster online dictionary provides the following example: The function of the heart is to pump blood through the body.

              To the extent that you can quantify a radio signal you can have an objective method for classifying signals. This does not mean the classification method is accurate. But SETI was just one example. I also mentioned having you explore another planet and presumably you could not quantify everything you see. That would not entail your classification was done on a whim.

              You write: “The classifications are . . . based on how we perceive and interpret the world and on our best understanding of the difference between natural and human-generated radio communications.” I agree with that in the sense that we always try to classify things on our best understanding of nature and artifact. I just don’t think this general classification scheme will always be objective or quantitative. That does not entail it is irrational.

            • Doc Bill

              Fine, but it the classification scheme is not objective and quantitive it’s not science. Therefore, ID is not science. But we’ve known that since ID was first proposed. We do know quite a lot about the “designers” of the ID scam.

              No, we’ll be totally hopeless at exploring another planet with living beings! We can’t even handle our own planet. We don’t understand whales, dolphins, crows, dogs or cats. We still kill whales and refer to all life on the planet except us as “lower forms.”

            • I said earlier that I’m interested in it as a philosophical (epistemological) question. Whether it meets a given definition of science is unimportant to me. I don’t expect science to be able to answer every question.

              And you didn’t really answer my point about exploring another planet. Have you seen a movie or read a book where the characters infer that a planet is inhabited based on discovering artifacts without seeing aliens? Are they irrational? If so, how would you rationally explore a new planet? If not, then it seems you admit that a non-scientific method can still be rational.

            • Doc Bill

              Oh, philosophy! I love bullshit! Best with a few beers, though. And, yes, I expect science to be able to answer any question posed, unlike philosophy which has answered absolutely none in all of history.

              Sure, I’ve been reading science fiction since I was a tadpole. I’ve probably seen every science fiction movie made, but drew the line at the Enterprise captain being that Quantum Leap guy.

              Almost all science fiction is human anthropomorphic. Obviously so because it’s written by humans with human experience. The galaxy abounds with Type M planets, Orion slave girls and tranya, or whatever that little guy drank.

              For an excellent spoof, but a little close to home, Google “sentient meat.”

              Much closer to home, I could take you to Egg Mountain in Montana and task you with finding a fossil. You’d probably be standing on one and not know it, but with some training you’d get the hang of it. We also know a lot about flint tools and how they differ from naturally occurring fractured flint.

              As for barroom pontification, I submit that an alien civilization visiting Earth would conclude that cats were the prime species and that humans were domesticated to take care of cats. It all makes perfect sense. My cat lives in a nice house, does not lack for food or attention and it is quite reasonable to conclude that his entire environment was constructed for his benefit. All hail Bastet!

    • cazimir

      Living systems exhibit clear features of intelligent design. The evidence is overwhelming and is so evident.
      The code in the dna specifies development, specifies functionality. Why isn’t evident for you that requires intelligence? Do you have other reason then” I don’t want to accept”?

      The evidence that unguided natural processes could do it, is zero. So why you call yourself a skeptic?

      The theory says non existent good copy errors or random mistakes created a system with brain, nervous system, heart, blood, lungs, kidneys, livers, digestive system. Any idea How, any idea in what order? Do you know that it’s not possible?

      S. Meyer:

      “Building an animal requires specified or functional information and any explanation for the origin of cambrian animals must identify a cause capable of generating digital information, structural information, functionally integrated and hierarchically organized layers of information.
      Each of the features of the cambrian animal and the cambrian fossil record that constitutes negative clues that render neo darwinism and other materialistic theories inadequate as causal explanations – also happen to be features of systems known from experience to have arisen as the result of intelligent activity.
      Standard materialistic evolutionary theories have failed to identify an adequate mechanism or cause for precisly those attributes of living forms that we know from experience only intelligence , concious rational activity is capable of producing.
      That suggests in accord with the method of historical scientific reasoning the possibility of making a strong historical inference to intelligent design as best explanation for the origin of those attributes.”

      Evaluating Real vs. Apparent Design
      by Randy J. Guliuzza

      ” Possibly the clearest observation of organisms is that they have multiple intricately arranged parts that fit together for a purpose. Many of these parts show proper alignment, exact dimensions and shape, tight fit, proper balance, and moving parts with precisely synchronized timing. These complex patterns are features of design that have been observed to originate only in intelligently designed items—never by natural forces.
      One fact about sections of DNA is that their four letters are precisely arranged as a set of plans and specification detailing the materials and controls to reproduce a new organism. Since DNA 1) selects 2) in advance 3) exact attributes 4) for a purpose, it has the same features of intelligence as any engineer’s specification. Throughout recorded human experience, plans and specifications are always a product of intelligence. In addition, all known natural processes that randomly choose letters one-by-one outside the context of an intelligence to guide the selection—as evolutionists assert—always yield nonsense that is totally inconsistent with information held in DNA.
      Another certain feature of design is demonstrated when engineers foresee aspects of their project that cannot be built by increments. They respond by establishing conditions so all information and materials are 1) available, 2) localized together, 3) at the right time, 4) capable of functioning together 5) for the intended purpose. Only intelligent agents have been observed to set conditions where all of the parts must be collected and built together or none of a specific function is obtained. Creatures have many examples of this all-or-nothing unity, but the best example is reproduction. Evolution is a dead end without operative reproductive abilities. Intelligent foresight best explains why the minimum number of parts necessary for an organism to reproduce—is the organism itself.

      Intricately arranged parts, information for specifications, all-or-nothing unity, and the impossibly low probabilities of these things happening in living things by chance are real observations. Their association to the actions of real designers is visible. Science is based on observation and testing. Real design is the better scientific explanation.
      A better scientific explanation supports a better approach to science. Since these features point so clearly toward real design, biological researchers should approach investigations of nature like engineers would study an unknown electronic device. They should expect to discover well-designed, coherent, and incredibly complex systems functioning for a purpose—an expectation forbidden by the rules governing evolution’s mental “thought prison.””

      • SmilodonsRetreat

        All the requirements for such claims are laid out. What is the evidence to support those claims?

        Other than further claims with no support…

      • Doc Bill

        cazimir – all of what you wrote can be summarized in a single word: bullshit.

        Foolish, foolish little troll, you have no concept of chemistry or you would not make such idiotic statements.

        But, humor me, and tell me the metric for design and how you would apply that metric to determine, objectively, what is designed or not.

        Bonus question, name a biological system, function or feature that was not designed.

      • josh

        “Intelligent foresight best explains why the minimum number of parts
        necessary for an organism to reproduce—is the organism itself.”

        Which is why losing an eye is the same as being impotent! Wait a minute….

        Intelligent design does not explain why you wrote this without the minimum foresight to avoid making a fool of yourself.

      • Christine Janis

        Yes, I can tell you the order (and, like all creationists, you’re thinking about vertebrates specifically human):

        A gut is seen in all animals, including sponges. So a digestive system came first.

        Some sort of nervous system is seen in coelenterates (which are more derived than sponges): all bilaterians have a nervous system. That came second.

        Some sort of blood is seen in all bilaterians. That came next.

        Within the deuterostomes (the bilaterian lineage that contains vertebrates), some sort of pumping heart is seen in most (sometimes multiple hearts, as in the chordate Amphioxus). But no discrete kidney in any non-vertebrate chordate, nor any discrete liver.

        With the first vertebrates, as exemplified by primitive living forms such as hagfish and lampreys, both livers and kidneys are seen for the first time. However lungs are not a feature of all vertebrates: rather, their presence is limited to bony fishes and tetrapods, so lungs came last.

        There, all sorted. Any other science you’d like to know?

        • cazimir

          Sure you didn’t answer the how part. How did random mutations invent all these? and assembled them in coherent systems. How did non existent good copy errors created genes for new organs when there were no such thing?

          If you answer, my next question will be and the evidence is….?

          • Doc Bill

            Nobody gives a rat’s ass what you think, cazimir, which is precious little from what I’ve seen. Crawl back under your rock, please.

            • Cazimir

              I’ve just asked some simple questions. I do care of what you think. Why don’t you answer does questions?

            • Tim Tian

              I’ve got a simple question for you. If no evolution, why sex?

    • Tim Tian

      If we were designed I do have one question: Why such a weak neck?

    • cazimir

      “Only positive supporting evidence for intelligent design can work. There isn’t any.”

      What is the positive evidence for random mutations adequacy not just to design (design is easy and even bad design requires intelligence) but to invent complex organs, complex devices in the cell, complex organisms?

      S. Meyer

      “Building an animal requires specified or functional information and any explanation for the origin of cambrian animals must identify a cause capable of generating digital information, structural information, functionally integrated and hierarchically organized layers of information.”

      Are random mutations capable? What is the evidence for that?

      S. Meyer

      “Each of the features of the cambrian animal and the cambrian fossil record that constitutes negative clues that render neo darwinism and other materialistic theories inadequate as causal explanations – also happen to be features of systems known from experience to have arisen as the result of intelligent activity.”

      Is this true?

      S. Meyer

      “Standard materialistic evolutionary theories have failed to identify an adequate mechanism or cause for precisly those attributes of living forms that we know from experience only intelligence , concious rational activity is capable of producing.

      That suggests in accord with the method of historical scientific reasoning the possibility of making a strong historical inference to intelligent design as best explanation for the origin of those attributes.”

      Is intelligent design the best explanation for the above attributes? If not what is and why?

      1. specified or functional information

      2. structural information (epigenetic)

      3. functionally integrated and hierarchically organized layers of information

      Are these positive evidence for intelligent design? If you don’t consider positive evidence why? and what are the positive evidence for your theory?

      Out of curiosity if evolution is false what possible alternatives could be?

      • SmilodonsRetreat

        Perhaps you should read all of my response articles to Meyer’s book in which I discuss many of the papers he misrepresents and ignores.

        The positive evidence that mutations can develop complex structures is all around us. From Lenski’s E. coli where a series of mutations fundamentally altered the biochemistry of the organisms to the single mutational events that cause massive changes to human shape. All previously mentioned on this blog.

        The positive evidence that mutations can result in changed body structures are also all around us. The mutations in genes that every living tetrapod has like opsins that result in changes to systems, but are connected to the other organisms.

        How about you define information for us? But, as I’ve talked about, a gene duplication by definition increases information. Subsequent mutations change that information. Again, discussed in this blog. Specifically in response to Meyer.

        As far as the hierarchical structure, will that’s an artifact of millions of years of speciation. Discussed several times as a common misunderstanding of creationists.

        Tell you what, find me an intelligence that has created a biological system, such as the immune system, and we’ll see if an intelligence can even create that. Doc Bill has mentioned this and it’s true. Meyer and all ID proponents are basing their creation of living things on an intelligence that can’t create living things. Quite amusing.

        The mind is the product of evolution, just like the body. The whole purpose of an organism is to spam the biosphere with as many copies of itself as possible. What does this better than humans?

        Define specified or functional information. Calculate it for the organism, gene, protein of your choice.

        Define structural information. Calculate it for the organism, gene, or protein of your choice.

        Well, let’s see. Before Darwin, there was discussion of Larmarkian evolution. Of course, we could be designed. If you have evidence for this, I’d be thrilled to hear it. But we both know that you don’t have any. And until you do, then you can attempt to discredit evolution all you want, it still doesn’t make ID true.

        Then there’s the fact that evolution is observed to happen. It has considerable predictive power. There are known mechanisms that satisfy the requirements of evolutionary systems.

        Heck, there’s more evidence for evolution than there is for the theory of gravity, but I don’t see anyone promoting “Intelligence Falling”.

    • cazimir

      You haven’t answered any of the questions , I wonder why.

      “Perhaps you should read all of my response articles to Meyer’s book in which I
      discuss many of the papers he misrepresents and ignores.”

      Can you show one just one article in which you presented relevant evidence that random mutations can build an animal? You spent five posts on chapter five without addressing the main argument of the chapter whether random mutations can generate relevant new information necessary for building an animal or can’t.

      I ask again, What is the positive evidence for random mutations adequacy not just to design (design is easy and even bad design requires intelligence) but to invent complex organs, complex devices in the cell, complex organisms?

      Don’t give me the EColi , all that happened was that the gene that codes for the citrate transport protein, which already existed and was active under anoxic conditions, was turned on in an oxygenated environment by being placed next to an active promoter. Anyway can you consider a tiny little step evidence that man can fly to the moon?

      I ask again, What is the positive evidence for random mutations adequacy not just to design (design is easy and even bad design requires intelligence) but to invent complex organs, complex devices in the cell, complex organisms?

      • SmilodonsRetreat

        No, I can’t point to just one article. Just like I can’t point to one article that gives all the evidence to support GMOs. I can’t point to one article that points to all the evidence that supports the germ theory of disease.

        You have a very poor understanding of even how science works. I have provided hundreds of pieces of evidence that, when combined, form a whole picture of how evolution works.

        You accept design with no evidence and reject evolution which has more evidence supporting it than almost any other theory we’ve ever discovered. You reject the evidence I’ve presented piecemeal without combining into a picture that is greater than the sum of the parts.

        I can’t help you anymore. You have made your decision and nothing can be done to help you.

    • cazimir

      “Only positive supporting evidence for intelligent design can work. There isn’t any.”

      1. specified or functional information

      2. structural information

      3. functionally integrated and hierarchically organized layers of information

      These are all positive supporting evidence for Intelligent design (Intelligent agents do this all the time)

      There is no positive supporting evidence that random processes can create this.

      Your argument is purely negative one – We don’t see the intelligent designer so therefore random errors must have done it. you are breaking your one rule “only positive evidence can work”. Isn’t that argument from ignorance or evolution of the gaps argument?

      “Meyer and all ID proponents are basing their creation of living things on an intelligence that can’t create living things. Quite amusing.”

      So if human intelligence can’t create living things the logical conclusion is that no intelligence required or a greater intelligence is required?

      What if humans will be able to create living things? Will that be evidence for intelligent design or for random mutations? What do you think? Scientists like Dawkins say that we are not far from creating (design) life in the laboratory.

      • SmilodonsRetreat

        Saying the same thing over and over doesn’t make it evidence… or even true.

        You can’t determine specified or functional information in anything and we both know it.

        You can’t determine structural information in anything and we both know it.

        You can’t use ID principles to determine hierarchical layers of information… although you can use evolutionary principles.

        And even if you could… IT IS STILL NOT EVIDENCE FOR INTELLIGENT DESIGN.

        I’m not making a negative argument. I asking for you to provide positive supporting evidence. You haven’t.

        As far as your last question. Sure, it will be evidence for intelligent design BY HUMANS. It’s not evidence for ALL intelligence design.

        Which is why the original post is still valid. To have anything at all, ID proponents MUST produce an intelligent designer. You don’t want to, because it’s god. Every major player in ID has admitted this to be the case. Of course, there is absolutely no evidence for god either. Oops.

      • Doc Bill

        I’m sorry, CaZ-Troll, what is your evidence for “specified or functional information?”

        Is it specified OR functional?

        Numbers, please!

        Here’s the deal, caz, nobody cares what you think because you don’t think. You just play “fetch the stick” like all dishonest, immoral creationists.

        I don’t play that game. Good-bye and enjoy your perverted life under your bridge annoying goats.

    • cazimir

      “Saying the same thing over and over doesn’t make it evidence… or even true.”

      Saying over and over again that it isn’t evidence for intelligent design doesn’t mean that it isn’t. And repeat it without any aruments.

      1. specified or functional information

      2. structural information

      3. functionally integrated and hierarchically organized layers of information

      Why aren’t these positive supportive evidence for intelligent design?

      “You can’t determine specified or functional information in anything and we both know it.”

      What do you mean by this ? Are you implying that we can’t determine if there is specified information or we can’t determine the exact amount of specified information?

      Does the digital code in the DNA specify the organism, it’s development and it’s funtions or not?

      S. Meyer

      “Thus, the inadequacy of proposed materialistic evolutionary causes or mechanisms forms only part of the basis of the argument for intelligent design. We also know from broad and repeated experience that intelligent agents can and do produce information-rich systems and integrated circuitry. We have positive experience-based knowledge of a cause sufficient to generate new specified information and integrated circuitry, namely, intelligence. We are not ignorant of how information or circuitry arises. We know from experience that conscious, rational agents can create such information-rich structures and systems. To again quote information theorist Henry Quastler: “creation of new information is habitually associated with conscious activity.”7 Indeed, whenever large amounts of specified or functional information are present in an artifact or entity whose causal story is known, invariably creative intelligence — intelligent design — played a role in the origin of that entity. Thus, when we encounter a large discontinuous increase in the functional information content of the biosphere as we do in the Cambrian explosion, we may infer — based on our knowledge of established cause-effect relationships — that a purposive intelligence operated in the history of life to produce the functional information necessary to generate those forms of animal life.

      Instead of exemplifying a fallacious form of argument in which design is inferred solely from a negative premise, the argument for intelligent design formulated in Darwin’s Doubt takes the following form:

      “Premise One: Despite a thorough search and evaluation, no materialistic causes or evolutionary mechanisms have demonstrated the power to produce large amounts of specified or functional information (or integrated circuitry).

      Premise Two: Intelligent causes have demonstrated the power to produce large amounts of specified/functional information (and integrated circuitry).

      Conclusion: Intelligent design constitutes the best, most causally adequate, explanation for the specified/functional information (and circuitry) that was necessary to produce the Cambrian animals.”

      The second affirmative premise in this argument makes clear that the design argument in Darwin’s Doubt does not constitute an argument from ignorance, nor is it a “purely negative” argument. Indeed, in addition to showing that various materialistic causes lack demonstrated causal adequacy, my argument for intelligent design also affirms the demonstrated causal adequacy of an alternative cause, namely, intelligence. My argument does not omit a premise providing positive evidence or reasons for preferring an alternative non-materialistic cause or proposition.

      In fact, the argument for intelligent design developed in Darwin’s Doubt constitutes an “inference to the best explanation” based upon our best available knowledge.8 As I note in Chapter 17 of the book, to establish an explanation as best, a historical scientist must cite positive evidence for the causal adequacy of a proposed cause. Unlike an argument from ignorance, an inference to the best explanation does not assert the adequacy of one causal explanation merely on the basis of the inadequacy of some other causal explanation. Instead, it asserts the superior explanatory power of a proposed cause based upon its established — its known — causal adequacy, and based upon a lack of demonstrated efficacy, despite a thorough search, of any other adequate cause. The inference to design, therefore, depends on present knowledge of the causal powers of various materialistic entities and processes (inadequate) and intelligent agents (adequate).”

      • SmilodonsRetreat

        OK fine. So, If I present you with two sequences of DNA, then you can successfully determine which one is designed and which one is totally random. And you can do so in a reliable manner that you can teach to anyone who will get the same results you do, yes?

        Whenever you’re ready, I’ll provide you with two sequences. Just let me know.

      • Tim Tian

        Here is a 538 base DNA
        ATTCGTTACCTACGCTCTCGGTTTCCCCTGCGCCAAGTCTATATTCTCTAAAGA CCTATGGTTCCCGGGCAGGCGCCAATTAGGGTGATCCATTGCCCATGCCCC TCA TGC AAA ATT GCG CCC AGT CGG ATT CAT GTT CCG CGG CGA CAG AAC CAA ACA TGT GCG TAC TAC ACC GCT ATC ATT ACG CCT GAA AAC TGT GTT AGC GTC AGA TAC GTC GAA CCG GGT CTA CTG GTG AGC ACC GTA CCA CCC TCA AGA TTG ATT ACA ATA CCC GCT AAA ATG GGA CAC AAT ACC AAC GTA CG TTA GTC ACT TTG CTC TCG TCA GCA GCC TTG ATG GAG GCA CCT CTA ACA CGG TCG TGA CAT ACT TGA GAT AAA TTA CGA CGT ACC AGA TCG AAC GTC CCC GTA CCG TAG TCG ACA ACA AGT ACT TCT TGT GCG CCG GCG TTC ATG CGG ACC AAC TCT TGA ACA GCA GCG ATT CTC TAA GAA CAT AGA AAA AGA CAT CTA GGA TCC AGG TGA AAC TTC GAG CAG AAA GTG GAA CGG ATT G
        Here is a538 base mRNA sequence (basically replace the U with T)
        AUGGUGCUGUCUC CUGCCGACAAGACCAACGUC AAGGCCGCCU GGGGCAAGGUUGGCGCGCACGCUGGCGAGU AUGGUGCGGA GGCCCUGGAG AGGAUGUUCCUGUCCUUCCCCACCACCAAGACCUACUUCCCGCACUUCGA CCUGAGCCACGGCUCUGCCCAGGUUAAGGGCCACGGCAAGAAGGUGGCCG ACGCGCUGACCAACGCCGUGGCGCACGUGGACGACAUGCCCAACGCGCUG UCCGCCCUGAGCGACCUGCACGCGCACAAGCUUCGGGUGGACCCGGUCAA CUUCAAGCUCCUAAGCCACUGCCUGCUGGUGACCCUGGCCGCCCACCUCC CCGCCGAGUUCACCCCUGCGGUGCACGCCUCCCUGGACAAGUUCCUGGCU UCUGUGAGCACCGUGCUGACCUCCAAAUACCGUUAAGCUGGAGCCUCGGU AGCAGUUCCUCCUGCCAGAUGGGCCUCCCAACGGGCCCUCCUCCCCUCCU UGCACCGGCCCUUCCUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC

        Can you tell which one’s random?