• Information and Intelligent Design… again

    Apparently, I have to do this again.

    It’s really quite simple.  Information, in the technical sense of being calculable, is not meaning.  It is trivially easy to calculate the amount of information in something.  Computers do it thousands of times a day.  They do not calculate the meaning or something.

    To a computer (and everyone else).

    JEBFGWUBGBWGWHIEGIWHOIGHWEGDSJFGUWOBGG

    has the same amount of information as

    THE QUICK BROWN FOX JUMPED OVER THE LAZY DOG.

    One of the above has meaning for a subset of the humans on the planet and one does not.  Meaning is simply not calculable.

    Why?  Because meaning is dependent on the on the environment.  To someone who has no knowledge of the English language, the second sentence above has as much meaning as the first.  Zero.  To a person knowledgeable about English, the second sentence has more meaning than the first.  How much more?  It’s incalculable.

    A person can be capable of reading the entire sentence, but not know what a ‘fox’ is.  That’s less meaning than it would be to someone that does know what a fox is.  What about a blind person reading this by braille, they know that ‘brown’ is a color, but have no idea what that really means.

    We can play this game in the real world just as easily.

    ATG GTG GAC CTG ACT CCT GTG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG
    AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG
    GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT
    GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG
    TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT
    CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC
    AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT
    GAG AAC TTC AGG GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC
    ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA
    GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT
    TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG
    TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT
    AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT
    TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA
    TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC
    CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT
    CTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTA
    TTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
    TCCTCCCACAG CTC CTG GGC AAC GTG CTG GTC TGT GTG CTG GCC CAT CAC TTT GGC AAA
    GAA TTC ATC CCA CCA GTG CAG GCT GCC TAT CAG AAA GTG GTG GCT GGT GTG GCT AAT
    GCC CTG GCC CAC AAG TAT CAC TAA GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTT
    CCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTA
    TTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAGGGAATGTGGGAGGTCAGTGCATTTAAA
    ACATAAAGAAATGATGAGCTGTTCAAACCTTGGGAAAATACACTATATCTTAAACTCCATGAAAGAA

    and

    ATG GTG GAC CTG ACT CCT GAG GAG AAG TCT GCC GTT ACT GCC CTG TGG GGC AAG GTG
    AAC GTG GAT GAA GGT GGT GTT GAG GCC CTG GGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAG
    GAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATT
    GGTCTATTTTCCCACCCTTAG G CTG CTG GTG GTC TAC CCT TGG ACC CAG AGG TTC TTT GAG
    TCC TTT GGG GAT CTG TCC ACT CCT GAT GCT GTT ATG GGC AAC CCT AAG GTG AAG GCT
    CAT GGC AAG AAA GTG CTC GGT GCC TTT AGT GAT GGC CTG GCT CAC CTG GAC AAC CTC
    AAG GGC ACC TTT GCC ACA CTG AGT GAG CTG CAC TGT GAC AAG CTG CAC GTG GAT CCT
    GAG AAC TTC AGG GTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTC
    ATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCA
    GGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCT
    TCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAG
    TAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCAT
    AATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTT
    TTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATA
    TACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGC
    CTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTT
    CTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTA
    TTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
    TCCTCCCACAG CTC CTG GGC AAC GTG CTG GTC TGT GTG CTG GCC CAT CAC TTT GGC AAA
    GAA TTC ATC CCA CCA GTG CAG GCT GCC TAT CAG AAA GTG GTG GCT GGT GTG GCT AAT
    GCC CTG GCC CAC AAG TAT CAC TAA GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTT
    CCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTA
    TTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAGGGAATGTGGGAGGTCAGTGCATTTAAA
    ACATAAAGAAATGATGAGCTGTTCAAACCTTGGGAAAATACACTATATCTTAAACTCCATGAAAGAA

    Are both alleles of a specific gene in the human body.  Both of these alleles are exactly the same length.  The only difference between the two of them is that bold letter.

    That’s called a ‘point mutation’ and it’s just what it says.  One point on the gene has changed from one nucleotide to another nucleotide.

    Since they are the same length and it takes the same number of bits to code for each letter (two bits in this case), then each allele has exactly the same amount of information.

    However, the MEANING of the two is very different.  One produces a normal HBB-B protein, while the other produces a mutant form of the HBB-B protein.  The mutant form results in red blood cells not being a nice torus shape, but instead a pointy, sickle shape.

    Yes, that one change is responsible for sickle cell anemia.

    The meaning of one of these alleles is incalculable without considering the environment (and the other allele of the gene in question).  In an environment without the malaria causing parasite, the normal allele has a higher fitness.  Because it doesn’t cause sickle cell-shaped red-blood cells, it is more efficient at transporting oxygen.

    However, in an environment that does have the malaria causing parasite, the ‘normal’ allele is at a disadvantage.  This is because the mutant allele creates red-blood cells that cannot be harmed by the malaria parasite (effectively).

    However, two alleles for sickle-cell are bad.  One allele is sufficient to provide malaria resistance.  Two alleles result in the disease ‘sickle-cell anemia’ and is worse than getting malaria.

    Now, if any ID proponent can write up and explanation, including the calculations and reasons behind the calculations, for how the meaning of these alleles can be calculated, then I will post it as a special guest post.

    If any ID proponent can provide me a link to a page where there are detailed instructions and examples for this process, then I will happily do the work myself.

    But until that happens, there is no reason to believe that information = meaning, in a calculable sense.  Which makes the ID proposition about said calculations (can’t create information and the like) meaningless.

    So if the ID proponent says that we can’t ‘create’ information, then they are wrong.  Because information is calculable.  So any mistake that increases the amount of bits required for the gene or whatever increases the information.  An insertion mutation, a copying of the gene, a chromosome problem that results in trisomy.  All of those increase information.

    Do, they increase meaning?  Maybe, maybe not, but until they can actually calculate meaning (and they can’t), then talking about it is a meaningless exercise.

    Category: CreationismGeneticsSkepticism

    Tags:

    Article by: Smilodon's Retreat

    • sstar

      I have been arguing with a creationist who conceeded that he could not calculate meaning but then went on to say that in any case the genome of all living things was “degrading” and information (as in shannon information) is constantly being lost in all beings in natural enviroments and is never increasing. Even though the loss of information might lead to increasing fitness in a given enviroment.

      • SmilodonsRetreat

        Two words “gene duplication” 😉

        When they say that duplication doesn’t increase the information, then they are confusing information and meaning.

        • sstar

          Do you know if there are any papers concerning gene duplication in the wild? The argument seems to be that such gene duplication has only been observed in experiments where the organisms were kept “safe”.