• The Bible Cured Cancer!

    healing_code_bookWhat happens when you mix the wackiness of homeopathy with the ridiculousness of religion? You get the Matthew 4 Protocol. I don’t know if you heard, but cancer has completely vanished from the face of the Earth. No, I haven’t noticed that either. But this morning I got an e-mail from The Washington Times telling me that the Bible has cured cancer.

    The e-mail begins by stating that atheists are speechless and can’t explain this. There is a healing message hidden in the Bible on page 856 of the King James Bible. This of course was an advertisement for a “groundbreaking” book. The e-mail directed me to a website which auto-plays a video explaining how on page 856 of the Bible there is a magical cure for cancer. The video goes on for a while, but never does give you the cure. For that, you have to sign up for the book.

    How cruel is this guy? He claims to be able to cure cancer with a simple secret found on a single page of a book almost everyone has or has access too, but he’ll only give it to you if you sign up to his mailing list. In the meantime, you have to suffer and maybe even die. If this miracle cure is so simple that it can be found on one page of the Bible, then you should just come out and say what it is.

    Well, I looked up Matthew 4, which is where the cure is said to be located and it talks about fasting for 40 days and 40 nights. So there it is. That must be the magical cure for cancer.

    How can I explain away this magical cure? 1. I doesn’t work and 2. People wrote the King James Bible, not God. Even if you are a fundamentalist religious person who believes that God wrote (or divinely inspired) the Bible, human beings translated and published it in the form of the King James Bible.

    Oh shit, an atheist just explained it! This “miracle code” is a fraud and it preys on people when they are sick, dying, and desperate. I know that The Washington Times are hard up for advertisers, but bounds of reason here.

    The website promotes Dr. Mark Stengler. He is a homeopathic doctor and author of almost a dozen books on homeopathic “medicine.” It seems that all one really has to do to get any attention is to invoke the Bible and then it is no longer a scam, it’s religion!

    That is the real Bible Code and that is what Brian Chambers figured out with his book, “The Bible’s Healing Code Revealed.”  Well, I have a Bible Code too. Just go to any page of the Bible and it will prove that the Bible is completely fiction! I’ll call it “The Atheist Bible Code Revealed!” 😉

    Enhanced by Zemanta

    Category: AtheismfeaturedhomeopothyimportantSkepticism

    Tags:

    Article by: Staks Rosch

    Staks Rosch is a writer for the Skeptic Ink Network, Huffington Post, and the National Atheism Examiner on Examiner.com. Currently he serves as the head of the Philadelphia Coalition of Reason and is a stay-at-home dad.

    2 Pingbacks/Trackbacks

    1,228 comments

    1. thanks for your post, being an agnostic myself, I agree with most of what you said, but I just wanted to pinpoint some flaws to improve your argument:
      – I’m a little uncomfortable with your stipulated claims about the Universe. Just like we don’t have sufficient scientific evidence to prove theories the early earth, we don’t have evidence to necessarily prove the big bang theory, only evidence that we take in support of it, and it does seem to be the best theory we have so far of the Universe’s early beginnings.
      – When the bible was written, while many peoples at that time certainly engaged in barbaric practices, this shouldn’t necessarily reflect on the writer of the bible himself. And keep in mind that he is only the messenger, too. Given that God exists, humans are responsible for their own actions, God isn’t responsible despite being all-powerful. We each are capable of doing “bad” things, and God allows us to God gave us free will. So theory that God is all that is Good still survives the problem that evil can exist in the world. Also, since a human was responsible for interpreting God’s word and translating it to the Bible, what the Bible claims can only be attributed to the writer(s).
      – also, if we do not feel after death, like you said, then it’s not necessarily inspiring for us. we could also take an apathetic attitude towards life, since we wouldn’t care about anything after death.
      – also, I think the logic behind “this is moral because God told us it is” actually goes a step further to “God is all that is Good and so that whatever he tells us must be moral”. If you follow this logic, then you’d see that God wouldn’t actually ever say rape is moral, so no problem there and you should exclude that from your criticism.

      Anyway, all problems you could possibly raise as an atheist can be logically addressed actually. So if theist wanted to, he/she could logically stand by the core ideas that embody the idea of God without any contradictions, etc. In other words, it’s not necessarily illogical to be theist. The only requirement is that you must accept on faith that God exists, since you can’t logically prove God’s existence.

      That goes the other way, too, for Atheists. Since you can’t logically disprove God’s existence, you must accept on faith that God does not exist. Remember that lack of evidence does not mean something does not exist. Before we had microscopes powerful enough to see atoms does not mean atoms did not exist until we had evidence of them.

      Of course, I’m claiming that one cannot prove or disprove the existence of god because very smart people have been trying to do so for thousands of years without success.

      Cheers!
      A.

      1. Wow, you have put a lot on the table and there are problems with just about everything you said. First, I’m an agnostic too. I am also an atheist. You seem to be confused about what those terms actually mean. Not to worry thought, I wrote a handy dandy explanation: http://www.examiner.com/atheism-in-philadelphia/religion-101-what-is-the-difference-between-atheism-and-agnosticism

        As for the Big Bang, I didn’t say this was proven with 100% certainty, I said (and I quote), “The evidence for this is almost as big as the universe itself.” The Big Bang theory is a pretty solid theory in cosmology. Sure new evidence can come along t disprove it, but that is the case with all scientific theories. It is however a pretty solid model with a great deal of strong supportive evidence.

        First, we know that there were multiple writers of the Bible. You won’t even find a Christian to dispute this as it is part of their narrative. Historians agree, except not necessarily on who the writers are, just that there were multiple writers. Also, The Bible is alleged to be divinely inspired by God. This means that if God wanted to convey a message, it would have been perfectly conveyed. So that barbarism preached in the Bible speaks to this point. Further, I didn’t even address the Problem of Evil here, but I did write about it in the Atheism 101 section on the tab at the top of the page.

        In relation to death, I don’t think you understood what I was saying. I wasn’t saying that after death we would care about our family and friends, I was saying that before death we care about our family, friends, and future generations. It is because we care about these people NOW while we are alive that we want to make the world a better place for them knowing that they will live on when we are dead.

        As for morality, I think you grasped what I said accurately, but the problem if something is good then God must approve doesn’t seem to fit with what the Bible claims is good. Basically what you are saying is God is on your side no matter what side you are on. This means that morality is completely relative and that whatever you believe to be good you can correctly justify by claiming that God also claims it to be the case. There is no way to verify what is actually good. It just becomes a matter of opinion. You can claim that god wouldn’t support rape, but the Bible stands against you on that and so does the rapist who believes that God agrees with him that rape is a moral duty. How can you prove him wrong? Do you God’s person contact information so that we can ask him directly if rape is moral or immoral? No, rape is immoral because it is an attack on another person, it causes harm both mental and physical, and it is not conducive to a productive society. I don’t care what some deity tells me.

        Finally, I have proven that God by definition cannot exist. See my post called, “The Ontological Argument Against God” or something like that. But I need not have to prove with 100% certainly that God doesn’t exist. I just have to show that it is not reasonable to believe in something on insufficient evidence. You can’t prove that Santa Claus exists either, so does that mean that you should make sure to put out cookies and milk every Christmas? Just in case. Of course not. How can you be certain that Santa doesn’t exist? You should be agnostic toward Santa just as you are toward God. But the issue is one of belief not knowledge. You don’t believe Santa really exists, do you?

        Thanks.

    2. Wow! It’s not everyday that I see someone manage to combine the old preacher’s trick of claiming to have discovered hidden wisdom by doing exegesis on their favoured ancient text with the old quack’s trick of selling people on the idea of a snake-oil cure-all.

      If there really were a magical cure for cancer, it would awfully unethical to hold it back for a single day, much less four hundred years. How strange that people would be willing to assume there is a good and loving plan in play here.

      1. I Am…..
        That’s what God is.
        S/he doesn’t give a fukk if we believe or not…..still IS.
        Brain God at work here…completely limited.
        Power is in Livng through the Christ Heart

          1. You claim to have ‘proved’that God does not exist…unfortunately, when one basis his theories on misinformation the result is obviously incorrect…scewed at the very least.
            Please review your facts and research your statements for valifdity prior to tossing out your ‘opinions’ and referring to them as fact.

    3. Hmmm…Matthew 4 Protocol? Not really sure what it means, in and of itself, but I dare say the “secret” here is more about “faith” and “trust” and unquestioning belief in a higher force than humanity; whether we want to call that “God” or something else.

      The beginning of Matthew 4 tells how Jesus (the alleged Son of God) came into the “state of enlightenment”…in much the same way as Buddha and others allegedly attained to their “higher understanding”.

      It seems the prayer and fasting and ultra-zealous commitment to learning Truth (with a capital “T”) might be enough to open some of the channels of the mind (and soul?) that most of us never experience; until, perhaps, at the end of our lives as we “pass on”(?).

      While some of this kind of thing surely sounds like “mumbo-jumbo”, I personally believe we are barely ‘scratching the surface’ with regard to the power of the mind, and the power(s) of the Universe, and the potential for humans to access those powers if they know how to do so, y’know? That is, IM(h)O. I’m just sayin’…

      1. When I was younger I was into all that mumbo-jumbo — even as an atheist. I was a level two Reiki practitioner. But the fact is that not a single controlled study has shown any of it to actually work. Until someone can present some actual evidence that the mind has healing powers I just can’t accept such a belief on faith or anecdotal evidence.

        1. Yeah, I know there are few, if any, “scientific studies” that can prove (or disprove) these things work (or don’t). Surely, there have been ample anecdotal stories and ‘eye-witness-accounts’ and other so-called evidence, but there’s always not quite enough to ‘prove’ anything. I guess that’s the reason for “faith”. Thx for the feedback.

        2. You are typical of someone with blinders and a limited mental capacity to grasp obtuse concepts that can’t be explained by the 5 senses. It is difficult to discuss things that are beyond your comprehension. But, I will leave you with this thought: your mind controls your immune system, you just don’t understand how. You are limited in your wisdom indeed.

          1. You may be correct that the mind does control our immune system, but I would like to see evidence of this before just taking your word for it. Your senses might be deceiving you and that is why science does studies to minimize conformation bias.

            1. Like I said, I won’t waste anymore time, but let me quit on this note, (not really sure why I’m even responding, I know where this usually ends up). Try and open up YOUR mind and quit being so narrow minded. How do you think you get rid of a cold or heal a cut, it is your mind/brain. It is done automatically, our conscious mind, (for most of us),doesn’t have the capacity to handle all of our autonomous functions. But there is a link to healing with the mind. I myself have rid my self of chronic back pain, through purging, prayer, surgery and cortisone shots. I was walking with a cane for a year. I’m sure you will say the medical process fixed it, but it was a combination, because the surgery didn’t initially correct it. I’m sure you know folks that have had back problems and surgery and they are none the better for it. The mind is very powerful. Negativity in your psyche manifests in the body and is unhealthy. You seem to be very negative and judgmental. Your mind can fix that too.

            2. Actually, you are the one being negative, judgmental, and close minded. Like I said before, my mind is wide open. I am willing to accept that you might be correct. All you have to do is present some valid evidence. That’s it. You on the other had are not interested in evidence. You have made it clear that your mind is made up and this shit works. No amount of evidence or lack of evidence will convince you. But the fact is that studies have been done on the power of positive thinking on health and those studies have shown that if positive thinking helps at all, it isn’t much. We are not seeing positive thinking healing people at a significant rate or number. It is basically within the margin of error. That’s just the facts. You can claim that you feel healed or that you believe your positive thinking healed you, but you have not provided valid evidence for these claims. You can name call me all you want and say that I am a negative, judgmental, and close minded person, but that doesn’t change the fact that you have no valid evidence for your claims.

              Come back when you have actual scientific evidence and I would gladly switch my position on this topic.

            3. I’ve got a novel idea. How about YOU prove that God and Heaven don’t exist and you can persuade all of us Christians to convert to your way of thinking.

              I’d personally rather believe in God and be completely wrong about it than to completely close off my mind and refuse to even consider the thought I could be wrong and then die and burn forever in a Hell that you don’t believe exists.

              Until you can prove to me that God does NOT exist – I’m just going to continue to have faith and believe.

            4. Well, I read about the wager but sadly, I’m not convinced He doesn’t exist. I guess you can believe He doesn’t exist if you choose – that is certainly up to you but I look at all creation and just can’t get there from here. I’m not convinced that each individual on this planet could just evolve into a human being created with trillions of cells, each unique with their own DNA and each with their own individual fingerprints – no two alike. How could anyone NOT believe in a Creator who could create billions of different people? That’s not to mention the birds, insects, trees, fish and every other creation that exists today. Talk about faith! To believe that everything that exists today just evolved from a dust particle or organism in to what we are today? To me, that might actually be having more faith than believing in a Creator and Almighty God.

            5. You read about Pascal’s Wager? Did you read all the logical problems with the Wager? If not, read more about it.

              Second, It isn’t faith when you have actual evidence. The evidence for evolution via natural section crosses every scientific discipline and has become pretty much settled science. Gravity is a weaker theory. This to me shows your complete ignorance about science and reality.

              This is the reason why I have to speak out against the ridiculousness of religion. You are making the world dumber by denying reality. Are you one of those people who believes that the world is only 6000 years old? I bet you are. You type on a computer that sends your words up into space and back down to Earth and into all the homes that can read my blog. That shit seems like magic, but it isn’t. It is science. It is how humans have been able to create tools using our understanding to the world through science. But someone like you could just as easily throw up their hands and say, “magic,” and that would be that. You don’t understand how people could have evolved from other life forms? God must a gone and done it. Magic!

            6. “You are typical of someone with blinders and a limited mental capacity to grasp obtuse concepts.”

              You seem to be very negative and judgmental. Your mind can fix that too.

        3. Wait until you get ill…medical industry takes all your money, STILL hasnothin to offer you….even hope. THEN, if you are as blessed as I Am….you’ll use your free will to Seek Truth….and you Will experience Christ’s healing. and SEE.

        4. Well, Dangerous talk : I have been blocked out by you or the author who keeps erasing my comments. I answered your last comment in full detail and either you (which I think was the author) or the author who is a atheist did not like my solid reply. I am being totally blocked out of this article comment now. I cant even comment on our discussion anymore. I have been stripped out. To bad, I was enjoying our discussion. I was looking forward to your reply to my detailed reply that I put great thought into —- But – O well!!! Later.

      2. “I personally believe we are barely ‘scratching the surface’ with regard
        to the power of the mind, and the power(s) of the Universe,”

        Channeling Chopra?

        1. I guess it was ‘discovered’ by some who learned to truly believe. I can’t say I’ve learned that yet, though I continue to work on it. I’m convinced there’s much more “power” available to humans than many of us realize…and it has to do with the spiritual realm, I think. I’m just sayin’…

          1. But believe what? If it only happens when someone believes in it, and it’s nothing someone would have imagined out of thin air, how would someone start believing in it for the first time? How do you “truly believe in” a thing that you’ve never heard of, and only exists if someone believes in it? It’s like the chicken and the egg, but purely mental. Where does it come from? And could you give a specific example or two of these abilities?

            1. Ahh…believe in “IT”, of course…lol.

              Seriously, I think some of these things are the kinds of things that are simply “given” to some people.

              Sometimes, we think of it as “Gifts from God”, like when certain children have some special talent at very young ages (playing piano, advanced mathematics, world-changing inventions and philosophies, and others).

              I wonder if folks like that might have something rather ‘special’ that most people never experience. And, if so, maybe it’s those people who truly learn to ‘believe’ in some of the ‘hidden’ forces out there, y’know?

            2. Sorry…no…I’m not saying a “developmental problems in children are a punishment from God”. I see you’re not ok with the “gift from God” thing, but that’s alright. In actuality, it might be that developmental problems may well be a sort of “punishment” for something, though I wouldn’t dare even attempt to try to figure out what.

              In Nature, offspring with less-than-desirable traits or other ‘weaknesses’ are often the ones that are selected by predators…Nature’s way of keeping the species strong. Likewise, those with desirable traits and strengths are the ones that thrive and keep the species going strong.

              Whether or not we want to believe some folks are truly “gifted” by God (or the Universe, or whatever else we wish to call the ‘forces’ which have brought everything to be) is probably immaterial, and perhaps I shouldn’t even use that term. But, to me, since I do believe in God (a Supreme Being or Intelligence behind all Creation), I like to think of people with extraordinarily specialized talents as being “gifted” in a positive way.
              I’m just sayin’…

          2. Believe how? If a thing doesn’t exist, even as a concept, how do you start to believe in it? Could you give me some examples of these “powers” so we can talk more concretely?

            1. These “powers” are way beyond my own understanding, but I am convinced there are “forces” all around us we just don’t understand, cannot even acknowledge, perhaps because we don’t yet have any ways to detect them.

              I think of life as being similar to many other things in Nature. That is, when we think of light, for instance, we know now that the whole electromagnetic spectrum, which includes what we call “visible light”, is actually much bigger and much more complex than what we are able to see or otherwise detect, except with specialized instruments.

              Actually, the same holds true for sound, smell, hearing, even touch. In other words…all of our senses only work within a very limited segment of the entirety of each ‘spectrum’. Without instrumentation, we wouldn’t even know about some of these things.

              We sometimes talk about our “sixth sense”…which is thought to represent our intuition, our ability to “know” about something without actually having any solid, verifiable ability or reason for why we might know that particular thing.

              So far, I guess we have not developed any instruments which can detect the rest of the “Life-spectrum”, but I am convinced it is much more involved than the current level of human awareness and human life as we now know it. Again…”I’m just sayin’…”

            2. But if you can’t even fathom what effects a thing might have, how would you start to “believe in” it, so that it could start to manifest those effects that you can’t even imagine?

            3. Ahhh…don’t get wrapped around the axle…I think you’re trying too hard to negate “faith”…which, as we know, is a belief in something that cannot (yet) be verified or ‘proven’ with means which will satisfy our “physical” senses or logic.

              There are many “unseen” and “unknown” things all around us, that we slowly learn of over time…and, some things we learn in depth, others, not-so-much.

              I think “faith” is one of those things many of us shy away from, since it smacks of ‘fairy tales’ and ‘fantasies’ that “educated, civilized adults” just aren’t expected to hold onto too dearly in our current society and culture. “If you can’t see, smell, taste, hear or touch it, maybe it doesn’t really exist” seems to be the mantra for much of this kind of thing, I guess.

              I’m just sayin’…

            4. I’m just saying, it seems kind of odd. Seems like you’d need to take a shotgun approach, and start sincerely believing in all sorts of random stuff until one of them manifested a “belief-based” effect.

            5. I’m not sure of the ‘shotgun approach’, although that’s probably not a bad analogy…but it sounds a bit too ‘accidental’. I think it’s just a matter of having an open mind to anything…anything at all. I think science has shown that the “impossible” often becomes the “possible” once it is better understood and studied and put through tests, and so on.

              We’ve seen evidence of this kind of thing throughout history…sometimes even at the risk of death or other peril…of some of those early “free-thinkers”. Societies and cultures attempt to control some peoples’ ideas on some things for various reasons (religious, political, economic, military, etc.), and it is sometimes difficult to broach new and fantastic concepts, even today.

              I think humanity is still very, very young (on the grand scale)…and it has a very long way to go before it truly understands some of the really important things about our own existence in a vast Universe rife with mysteries and miracles we simply cannot begin to fathom, y’know?

    4. Weeeeee….look everyone – I’m an ATHIEST!! I don’t believe in anything and I’ll just be worm food after I die but before I go – I’ll ridicule everyone who has faith in God. Sure, I’m not helping anyone but it makes me feel better about my empty, unfulfilled life!

      1. Weeee… look at luckydc@gmail.com – He’s the guy ridiculing people who he falsely claims ridicule others and is too cowardly to sign his name.

        As for me, I criticize ridiculous beliefs because many of those beliefs are dangerous! This Bible cure for cancer is a perfect example. People with cancer should see a doctor instead of trying to find some hidden medical cure in a 2000 year-old book written by sheep herders.

        1. Not sheep herders. fishermen,physician and James and Jude half brothers of Jesus and Paul aka as Saul who was a very educated man and at one time a very important man of the Jewish religion, He killed many Christians until he met Jesus and his life was changed forever. Read your history

          1. Sorry, but Paul never persecuted, much less killed any Christians. There weren’t any Christians at the time, or for years after that. He persecuted Jews who believed that Yeshua (Jesus) was the promised Messiah, and he went into synagogues (not churches) looking for those Jews. Until his death, and through his writings, even beyond death, Paul was important in the Jewish religion. If your church has taught you that Paul persecuted or killed Christians, you might want to consider what other erroneous teaching they have foisted on you.

      2. Your life wouldn’t be empty and unfulfilled if you had faith in God. I feel sorry for you on judgement day. Praise God in the highest!

        1. My life is far from empty and unfulfilled. Shame on you for judging my life without knowing anything about me and shame on you for your threats of eternal torture. Fortunately, your threats are empty because Hell is imaginary too. Reality is much more fulfilling than 2000-year-old horror stories.

          If you had evidence for your claims, you wouldn’t need faith. But since you have no evidence, all you left with is faith. How do you know that your deity of choice is real?

          1. If you, the atheist, are correct you die and worms eat your rotting corpse. If you are incorrect you die and the worms eat your rotting corpse. I have Faith in the true God, you have no faith and no hope and maybe it is because the path to hell is wide and the way is easy. The path to heaven is narrow and few will enter. You have condemned yourself by choice. Good for you.

            1. If I’m right and there is a billion dollars in everyone;s backyard, then you will live the rest of your life without a million dollars, but if you are right and there isn’t a billion dollars in everyone’s backyard, then you still won’t have a billion dollars. I have faith that there is a billion dollars in everyone’s backyard. You just need to look for it. But you have no faith and no hope of every finding a billion dollars in your backyard. That’s so sad. Poor you. :-)

            2. RECALL NOTICE:

              The Maker of all human beings (GOD) is

              recalling all units manufactured, regardless of

              make or year, due to a serious defect in the

              primary and central component of the heart.

              This is due to a malfunction in the original

              prototype units code named Adam and Eve,

              resulting in the reproduction of the same defect

              in all subsequent units. This defect has been

              identified as “Subsequential Internal Non-

              morality,” more commonly known as S.I.N., as

              it is primarily expressed.

              Some of the symptoms include:
              1. Loss of direction
              2. Foul vocal emissions
              3. Amnesia of origin
              4. Lack of peace and joy
              5. Selfish or violent behavior
              6. Depression or confusion
              7. Fearfulness
              8. Idolatry
              9. Rebellion

              The Manufacturer, who is neither liable nor at

              fault for this defect, is providing factory-

              authorized repair and service free of charge

              to correct this defect. The Repair Technician,

              JESUS, has most generously offered to bear

              the entire burden of the staggering cost of

              these repairs. There is no additional fee

              required.The number to call for repair in all

              areas is: P-R-A-Y-E-R. Once connected,

              please upload your burden of SIN through

              the REPENTANCE procedure. Next,

              download ATONEMENT from the Repair

              Technician, Jesus, into the heart component.

              No matter how big or small the SIN defect

              is, Jesus will replace it with:
              1. Love
              2. Joy
              3. Peace
              4. Patience
              5. Kindness
              6. Goodness
              7. Faithfulness
              8. Gentleness
              9. Self control

              Please see the operating manual, the

              B.I.B.L.E.(BEST Instructions Before Leaving

              Earth) for further details on the use of these

              fixes.

              WARNING: Continuing to operate the

              human being unit without correction voids

              any manufacturer warranties, exposing the unit

              to dangers and problems too numerous to list,

              and will result in the human unit being

              permanently impounded. For free emergency

              service, call on Jesus.

              DANGER: The human being units not

              responding to this recall action will have to be

              scrapped in the furnace. The SIN defect will not

              be permitted to enter Heaven so as to

              prevent contamination of that facility. Thank you

              for your attention!

              – GOD

              P.S. Please assist where possible by

              notifying others of this important recall notice,

              and you may contact the Father any time by

              ‘Knee mail’!

              Because HE Lives!

              Working for God on earth doesn’t pay much…but

              His retirement plan is out of this world!

            3. What a poor design on his part then. Too bad he didn’t have the foresight to see how bad his product would turn out. If he did, then he wouldn’t need the recall. Besides, free will is an illusion.

            4. Once again “Dangerous” you throw insults but don’t want to be insulted. Simply because someone isn’t following YOUR thought process doesn’t mean they aren’t thinking. They’re just not thiinking like YOU. Free choice right? I’m just saying You have the choice to be sarcastic or not, which has nothing to do with YOU thinking, right? I thought the remark about you thinking for someone was a good retort by itself. That was top shelfthe last part put it underneath the bar, below your class if you will. Just my opinion, which probably is worth much to you. But hey it’s mine.

            5. Waste your time if you want. It’s ultimately the power of the mind and thought. It’s not WHAT you believe it’s THAT you believe. Believing in the Easter Bunny will get you the same results. “and the WORD WAS god”. A word is the manifestation of a thought; get it???

            6. Your parents fucked up their design DT. I’m going to guess your mommy’s a whore and your daddy just a shadow in her dreams.

            7. Lol, wow how did you know? I love how nice Christians are and then they accuse atheists of being the meanies. I guess if you don’t have any evidence for your claims, just call people’s mothers a whore. Personally, I think whore get a bad rap. I mean they get to have sex all the time and that’s awesome. Plus, they get paid for it and that is even more awesome. If my mother was a whore, I would be damn proud of her. But then again, I’m damn proud of her no matter what she does because she’s my mother.

            8. if there was a like comment button here, I would click it!
              good on you for loving your mother like this!

            9. NO!! That statement was the stupidest of all the statements I have read so far in this discourse. Every parent does their best to raise their children the best they can.
              And everyone is valued by God, our Creator, whether we believe in Him or not

            10. How can you claim to be a “true follower of Jesus” and yet reject that this guy is? He claims to be a “true follower of Jesus” and would probably say you are not. Neither of you actually follow the Bible, so I don’t really think either of you are true followers of Jesus. But whatever.

            11. Well, let’s just say that I’m not a follower of Jesus, that statement is still wrong. And it’s not an ignorant statement, it is a stupid statement and is only harmful to a healthy discourse. I’m sure all of us can agree on that.
              However, since I am a follower of Christ, I can say that that statement is also something that Christ would not approve of. Now, that doesn’t mean that I claim to know the mind of Christ or God, far from it, but I do know what Jesus taught. He taught us to love everyone just as He loves us. And there are no conditions on that love. If you spit in my face I am still to love you. Jesus also teaches that if another follower of His makes a misstep and says or does something stupid as the commentor above did, then it is my duty as a follower of Jesus to point that out to the brother or sister in order to help them stay on the ‘right track’.

            12. Jesus also taught to hate your family and to give away all your money. Do you hate your family Scott? Did you give away all your money Scott? He also said that it was better to cut off your hand and pluck out your eye because it is better to lose body parts than it is to lose one’s soul in Hell to be tortured for all eternity. I’m just trying to let you know what Jesus said to help you stay of the “right track.” Although, I don’t really think that is the “right track” after all and I think you probably should stray from it for your own good and the good of the rest of society.

            13. Here’s the problem. Everyone, including christians, take excerpts from the bible to try and prove or disprove a point. However, the bible has to be considered as a whole in order for anything to make sense.

              Christ did not tell us to hate our family. What that means is that if we love our family more than we love Christ, then we need to rethink.
              If we love money more that Christ, we need to rethink.

              Our family, although very important, cannot save us from the fact that someday we are going to die.

              The LOVE of money is the root of all evil, not having it.

              And if you will consider the bible from cover to cover, you will find that God and Christ lay great importance in the family.

              Consider that Christ while hanging on the cross, dying for all mankind, he took to time to put the care of his sweet mother into the hands of John.

            14. The Bible isn’t a whole!!!! It is 66 separate books written by a variety of different people (many of whom were anonymous) at different times, for different reasons, with difference messages. Then they were voted on, edited, translated, mistranslated, etc. We don’t even have the originals. In fact, there may not have even been originals.

              You are altering what the Bible says right here. The Bible does not say that we should love Jesus more than our family. It says that in order to follow Jesus you must hate your family. That is what our oldest Bible has to say. Jesus talks about giving all your money away — not once, not twice, but multiple times. He was very clear on this point because he wanted his followers to spread the word that the end of the world was coming within a single generation. Give your money away and let everyone know. Oops, Jesus was wrong. 2000 years later we are still here and you have still not given away all of your money like Jesus repeatedly commanded you to do.

              Actually, our family is the thing that can save us from the fact that we are going to die. We live on through our family. I will continue to live on even after I die because my genes have been passed onto my children. My knowledge and experience has been imparted to those around me and so I will live on though those who remember me.

              Jesus repeatedly commanded his followers to give all their money away. Yes, the love of money is evil, but he also said that his followers should give all their money away and focus on preaching the end times. Read your Bible; it’s in there.

              No, God says that men are important and that women are merely a man’s property. If a man rapes a single woman, he must pay the woman’s father for damaging his property. If a man rapes a married woman, then he has committed a crime against the woman’s husband. But it is never about the woman. Jesus disrespected his mother and called another woman swine. He didn’t care about women either. It isn’t’ about the family; it was always about the men and worshiping the deity. Jesus told his followers to hate their family and follow him. He was the Son of Man.

              He took the time to give his property over to another man. How sweet, lol.

            15. Again, you are correct. The bible was written by different people. Over many years. And through the years mankind has made errors in translation and some make it say what they want it to say. This is why you have to look at the bible as a whole and understand the history behind it all.

              Even I can mis-state what the bible says. But one thing that I will always stand firm on: Jesus is NEVER wrong.

              Jesus put his mother in the charge of someone else so that when He was gone He could be sure that she is taken care of. I do the same thing when I have to go away for a few days from my family. I put my eldest son in charge of the household be cause is is the oldest male who will be in the house while I’m gone. I do this not because my wife is my property, but because I love her and want her taken care of.

              The entire bible, including the old Testament tries to teach us that women are important. Take the story of Rahab, possibly a Harlot, but because of what she did, she was part of the family line that produced our Savior, Jesus. Then there is Ruth, Esther, Mary-Jesus’ Mother, Mary Magdelene and so on. If you look at the history behind the writing, it was done by men who believed that women and slaves were property. It’s not right, but God does allow us free will to chose to do the wrong or right thing.

              The Scriptures lay out how the family hierarchy should work. The father is the head and is to love his wife as Christ loved the church even unto death. What about that is disrespectful to women?

              Children are to respect their mother and father.

              Thanks to Esther, a King changed his mind and did not wipe out the entire Hebrew nation.

              Proverbs pays close attention to the importance of the family and the wisdom that can be gained from the family unit. The Song of Songs talks about the love relationship between a husband and wife and tells how the man should be gentle and loving and respectful to his wife. Show me this disrespect there?

              Ok, I just gave you a lot of ammo. Go!

            16. I just pointed out to you where Jesus said that the end of the world was coming within a single generation and the obviousness that he was wrong and then you say that no matter how much evidence I point out, you will dogmatically hold that Jesus was never wrong. Look, I’m open to you convincing me that I might be wrong. If you can present some valid evidence for your claims, I will believe them. I hold nothing as dogma. But when you say that no matter what, you will “stand firm” on the view that Jesus was never wrong even after being pointed out places where Jesus was absolutely wrong, then I don’t know what to tell you.

              To claim that the Bible authors do not treat women as property is absurd. I pointed out some examples of this already and I didn’t even mention where Paul talks about how women shouldn’t be allowed to teach men or how women are called, “unclean” while menstruating. I didn’t point out how women were created from man’s rib or how even though Eve ate the apple first, it was Adam’s sin that was the cause of “original sin” (a ridiculous concept in and of itself). The Bible is not just anti-woman, it is extremely anti-woman. You would have a better case if you were arguing that the Lorax hates trees than the Bible loves women.

              The thing is, I get the impression that you really haven’t actually read the Bible cover-to-cover. You also don’t seem to know how it has changed over time or how verses have been interpreted over time. Women didn’t get the right to vote in America until the 1920s. This was largely because the Bible is anti-woman. Those who led the suffrage movement were many atheists and secularists. Just as we are the force fighting for the rights of gays and lesbians today and we were the force fighting for civil rights in the 1920s and ’30s too. The Bible is not a book of peace and love. It is a book of hate, fear, discrimination, and death, and then eternal torture.

              I do have some great news though, it’s almost all fiction. Genesis was just a myth told by primitive people to understand the world, The Exodus never happened, most in not all the wars in the OT never happened, Jesus probably didn’t even exist either. Their is no contemporary accounts of his life or death and much of his story was stolen from a guy name Simon who lived a few years earlier. The great news is that Hell and Heaven don’t actually exist and that God is imaginary. You are free to live your life and create your own purpose. Enjoy your life, it is the only one you have. :-)

            17. Ok, lets go bit by bit. First, I never said that the men who wrote the bible did not think of women as their property. I believe the historical evidence actually supports that. However, I will tell you that most bible believing folks to not ascribe to that belief because God ultimately teaches us through the scriptures that we all have value and we all have a purpose whether we are Male, female, slave, free, etc. The fact that Eve was created from Adam and that it was Adam’s sin merely establishes the family structure. The man is the spiritual head of the family and the female is his helpmate. Each one has their role to play, but the man is ultimately responsible for his family.
              Jesus and His prophecy. His prophecy was not wrong but was a warning that we need to live in moment by moment expectation of His return. After all, even Jesus does not know the time of His coming. God, the Father, will let Him know when it is time.
              Unfortunately, the bible has been translated in many ways by fallible mankind. Women have been treated unjustly through the years just as have slaves of all colors, nations, and tribes.
              As far as the bible goes, I think this is what the bible as a whole teaches us.
              In the old Testament we start with God establishing the fact that He is the creator of all things. And He lets us know that He desires a relationship with us whom He created in His image. He communed and walked with Adam and Eve in the garden. He chose a people, the Hebrews, through which He would make Himself known to the world. But, mankind is sinful. Because of free will we have fallen from the original state that He created. All the rules and laws in the old Testament are there to show us that there is nothing we can do to justify our sinfulness in God’s eyes. There is nothing we can do to restore us to that original state. But, because God does love us and wants to have a relationship with us, He provided a way for us to be reconciled. Thus, we have the New Testament. He sent His Son, God in the flesh, to experience what we experience. All of our temptation, pain, suffering etc, He knows our life. The Jesus, in fulfillment of prophecy, died on the cross for the sin of mankind. All of us. Including those who don’t believe. He was sinless, perfect. The spotless lamb sent for our sacrifice. By believing in Him we are able to be restored and justified to God. The greatest story/truth is that we don’t have to work to prove ourselves, we simply believe in Christ who has already done the work.

            18. I read your article on free will being an illusion and I believe that you are making a logical misstep and that you also misrepresent what free will actually is.

              We will begin with the misunderstanding. First of all, free will is NOT “complete control over our actions.” It instead is a statement that we can make choices although within an understanding of free will one can also agree that our choices of actions are LIMITED by our environment and genetics.

              If you had begun with that premise, I believe that it would have been easier to read your article because about half of it seemed to be stating this point, with which I happen to concur but then you go on and this is where I believe your logic breaks down. This could be because I have not quite grasped the nuance of your argument and so perhaps you can demonstrate where I have gone wrong in my understanding of it but you refer to our choice as a “determined choice” and that because we do not consciously realize our choices are being shaped on the subconscious level, then free will is an illusion. Fair enough. However, would you go so far as to argue that choice itself is an illusion? After all, if our choices are COMPLETELY determined by genes and environment, there is no choice at all and that is where the argument breaks down because you earlier argued that “My claim isn’t that we don’t have choices but rather that our choices are not “freely determined.”” The only case where your argument will not fail the logic test is if you would agree that our choices while not completely free are not completely determined either.

              What appears to be your argument opens up a can of worms with regard to our criminal justice system since our entire concept of culpability must be tossed out. After all, if our choices are predetermined, then how can one be held responsible for one’s actions in the first place? Indeed, what is the point of punishment at all?

              Yet ironically science offers you (and the believer) a way out. Quantum mechanics suggests that there is, in fact, some degree of randomness in the universe and that even on the subatomic level particles make “choices” that are of a nondeterministic nature. In such a case, we have free will and it is not an illusion (though the degree to which we have free will may be illusionary) but then again so do subatomic particles which quantum mechanics has already shown behave in an indeterministic manner.

              Please correct my misunderstanding of your point if I have misrepresented it.

            19. This isn’t really the space for this conversation, but okay.

              You make a choice and you think you are free to make whatever choice you made, but the fact is that the you that made that choice didn’t really have a choice at all. That choice was determined by your nature and nurture. You can choose whatever you like, but what you like was already chosen by your nature and nurture. It is all an illusion.

              You are looking at the justice system all wrong. We shouldn’t put criminals away to punish them, we should put them away to keep society safe and to hopefully influence their nurture so that they come out of prison and no longer commit crimes. Some will also claim that putting criminals in prison will influence the nurture or other people who might otherwise commit crimes, but being exposed to this new data, are now deterred.

              Sam Harris has a great book on Free Will, called “Free Will.” It isn’t a perfect book and it leaves a lot out, but it is short and a quick read. I highly recommend it: http://www.amazon.com/dp/B006IDG2T6/ref=nosim?tag=dangtalk-20&linkCode=sb1&camp=212353&creative=380549

            20. Thanks. I will read the book. However, you are taking me a little too far when you say that I am “looking at the justice system all wrong.” I agree with you regarding your statement about trying to keep society safe but that can be accomplished far better by NOT placing them in prison. Prison is hardly the ideal sort of place to generate rehabilitation. Indeed, it is FAR better to isolate them from society but generally let them have a degree of freedom within that isolation. See, for example, the great work that Scandanavian countries have done in this regard. However, this is still very problematic because we must dispense with the notion of culpability if free will is an illusion. After all, what is the difference between someone who is insane and someone who is sane when it comes to a crime if there is no free will? There is none. The mere statement that they know the difference between right and wrong is meaningless. This will cause grave issues within the broader society because regardless of how you or I feel, people want to see “justice” and to them justice means “punishment”.

              Still, I encourage you to think about this from the standpoint of quantum mechanics and recent advances in mathematical philosophy. See, for example, the Free Will Theorem by John Conway and Simon Kochen, which demonstrates that if free will exists then it also exists at the subatomic level.

              Of course, I think that our disagreement over the nature of free will could also be that we are in two different philosophical camps. Your definition of free will ends up determining your belief that free will is an illusion because you believe that Benedict de Spinoza is correct in his assertions and that the work is inherently deterministic at its source. I, on the other hand, view the world as inherently indeterministic because I am a metaphysical libertarian who believes that your actions originate solely with you.

              Of course, I cannot disprove your determinism but you similarly cannot disprove my assertion that there is free will. Indeed, the funny thing is that if there is no free will, there is no point in this (or ANY) attempt to alter reality because reality itself is an illusion with us playing out on a grand stage a massive computer program set in motion at the beginning of creation. Without free will, the nature of sentience is meaningless. We think we exist as independent agents but we do not. Then again, the realization of this is also part of the program as well. Life ceases to have any purpose at all without free will and morality itself is meaningless as well. This entire conception of the universe is something that I, as a committed libertarian, cannot believe (guess I am deterministic at least in that sense then).

              In any case, I look at quantum mechanics for my answers. It is clear from studying it that the world is not as deterministic as you might think.

            21. Actually, God did have the foresight to know that we would choose wrong over right which is why he offered his Son, Jesus, to be the ‘fix’ (for lack of a better term) for the problem. Also, your last statement, ‘Besides, free will is an illusion’ is very interesting. Are you sure you’re not Calvinist instead of Atheist? ; )

            22. Actually, according to the Bible, it wasn’t “foresight” it was aftersight. Second, if God were so perfect, then he wouldn’t have needed the contingency plan at all. Third, science has already shown free will to be an illusion. As a statement of fact, our decisions are based off the complex interactions between our nature and our nurture — our genetic disposition and our environmental conditions. Scientists have actually been able to predict what someone will do seconds before they do it just by studying their brain at that moment in a lab. Calvinists believe God decided. I don’t believe in any gods. So no, I’m not a Calvinist but at least their beliefs are internally consistent on that point.

            23. it’s called free will, everyone gets to choose for themselves. Imagine how boring the world would be if we were all like robots doing the same thing.

            24. “free will” is nothing more than the mind responding to information it recieved by processing it thru the neural matrix that is your brain. With sufficient knowledge of the information and the mind processing it the answer will always be known (an all knowing being would clearly possess such) and if the information being input and the mind processing it were created by a central source (directly or not) then that source ultimately governs the outcome. God can not be absolutely responsible for creation and omnipotent of that creation and claim ignorance as to the consequences of those actions.

            25. “Free will’ is the biggest cop out of all. It’s the only way you can rationalize that an ” all loving, all knowing, all compassionate being” created this little shithole called Earth.

            26. No, He just gave people like you freedom to choose between faith, and unavoidable death. Maybe one day your 99% accurate science will fail you and you will have nowhere else to turn than to Christ. Maybe not. It honestly is up to you and only you can decide. I have already given you one of many times God has answered my prayers somewhere down under in the blog. For now, keep drinking that kool-aid. When all you have is the faith in a doctor who is usually mosty right, good luck, I’ve found with most doctors you will need it!

            27. So you believe in God because you prayed that it would stop raining and it did? Really? That was a “sign” that God was listening to YOU. What about the tens of millions of people who are suffering in the world who pray to God and are still suffering? Go ahead and tell them. Tell them that they are still suffering despite their prayers because God was too busy making it stop raining for you.

            28. DT, While I was driving however fast, I was searching for a tree, a wall, an end. You do not know me or what I have been through. I was losing faith. I did believe, I do believe, but death in itself is NOT God ignoring man. Sometimes it is just time to go. I am only 25. I have had Multiple Sclerosis since I was 15. I was at that point debating between graduating a year early and going to the Air Force Academy to become a pilot on a scholarship or just graduate with my class. Regardless I had my future planned to a point. For nearly 10 years I walked like a zombie, having had fate slam my life to the mud. You know something, all my life I have focused 100% of the time on people. I would give up a lung if I was asked. I wanted to throw it all away that day but I do believe God stopped me. I do not believe in coincidence.
              Another time my family was “coincidently” saved. My youngest 2 brothers were sitting in the back of a pickup with a cap. They were playing cards while my dad drove them somewhere. (This was years ago, I was not with them and do not remember what they doing that day to be in the truck) The cap flew off on I75. They had laid down not even a second before it flew off. Had it hit them, they would be dead.
              God is everywhere. He is beyond time. He hears all prayers and some people He is just ready to bring home. And there is a huge difference between praying to have God do something for you and honestly asking God to be with you.

            29. So what you are saying is that God saved you, but didn’t care about all the other people (many of which are believers) who are suffering in the world. To the starving families on the city streets, who pray for a job so they can feed their kids, to the the little girl in the hospital who needs a lung transplant; God doesn’t answer their prayers, but he made it stop raining so that you would feel like not killing yourself.

              I was suicidal too at one point and so I can relate a little bit to what you are saying. I asked God why, he was punishing me and allowing those who hurt me to prosper. He didn’t answer. It took me many years to figure out, but the truth was that God doesn’t exist and that I wasn’t the good guy and my enemies weren’t the bad guys. We are all shades of gray. We are all just people trying to do what we think is best and sometimes getting sidetracked along the way. Sometimes we do things that aren’t good. There is no cosmic justice in the world. If we want to atone for our misdeed, prayer to an imaginary deity isn’t going to cut it. We have to try to make things right for those actual people we have wronged or to those who loved them.

              God didn’t stop the rain, the lack of moisture in the air stopped the rain. My son is in pre-school and he is already learning about how moisture builds up in the clouds and when they reach saturation, it rains. When there is no more moisture, it stops raining. Rain dances and prayers don’t control the weather.

            30. Wow, ok so I think I have heard enough about religion and belief, atheist and Christians, and those who may have quantum mechanical physics etc.. These comments fist off were to be in relation the above taped advert of Bible un coded “Cure for Cancer” or such.. Then somehow it lead into a slander of Christian’s beliefs and the bible.. to more of all the above with a Buddhist story and monk.. Wow.. how can one get off track so easy trying to impose or stress their belief’s on another.. While I do not care to continue to read comments. Let me say.. Curiosity kills the cat and maybe this is why ANY of us clicked on the link to find out what this was all about.. So I commend anyone for doing so as seeking answers to a question is first and utmost building knowledge yfor weather it was done with close minded how as I was clicking on it. Yes I felt it to be a farce but ok lets see what scam is out there this time. So get over it. Sad part is some people will believe it. Simply said!
              But I cant leave without making my own comments. Let me make this perfectly clear! Nothing anyone can say or do can take away my faith in Christ or God or anything to do with my Christianity.. So yes I am Christian.. Do I condemn Atheist? Not a chance! Do I feel sorry for you? Yes I do. Are all so call factual scientific evidence correct? NO. If you believe that then you are placing your self in a situation to have faith on MAN. You mention to those who are ill and seeking their faith based prayers going un answered. You also mentioned you were once a believer and now an atheist. Lets address both of these issues. The first one. Fact based theory that Doctors have found Radiation and Chemo to assist those with cancer are all curable. Ok lets back up.. to “help kill the cancer” however with that said, the true fact is not just radiation and chemo. It is a healthier life style eliminating certain foods, drinks, etc.. So fact of Radiation and Chemo be the scientific fact is not true. You see, those answers that mentioned of being in the bible is in deed true as the bible does dictate to one on how to obtain health and cure ones self of ailments. The good Lord (or those who you indicate wrote the words) do explain that all that man needs comes from the earth, yatta yatta, meat protein etc.. what to eat and what not to eat. Now look more so into the pharmacology of medicines.. All medications are derived these days from those plants that were grown from the earth.. They develop the study of each plant and it’s purpose as well of combinations of and re create them in a synthetically and controlled environment with additives and chemicals for preservation and speeding up the process etc. This is FACT.. If you do not know this then gain some knowledge.. The same is for Food processing this day to meet this fast pace world we live in. Fact is when it comes to healing a body, we this day in age rely on Physicians to heal with their knowledge of these man made synthetically altered medications injected into our bodies all the while praying to God as man has his input in curing. You ask your doctor if he know the compounds of any medications he administers to his patient along with that scientific study etc and trust he had no clue. He trust and instills his faith upon a research and pamphlets provided to him by the FEDERAL Drug Administration, journals, but mostly by “REPORTED RESEARCH” which again is by man and large companies who have spent countless hours and money to make money to ensure that this medication is beneficial for the public use. When in fact most of these medications alter, disable, and kill the general public. While I do not advocate to stop going to the Doctor and seeking medical advise and prevention of ailments, I do say one has a choice to place their faith in that Doctor and the Good Lord and after that one choose which path to take to place most faith in.. If one is not working, then we are all given a free choice to take the alternative and investigate once we have a diagnosis as to our resources. This used to be the factual case, however when it comes to children, many states remove that from the hands of a parent. Now lets back up even a bit more. On factual evidence. Man makes vehicles, whiskey (alcohol) wines (while this was made way back when) they make planes, homes, tractors, guns, knives, etc.. Men make choices. Man makes a choice to get in a vehicle drunk, kills another, man makes a choice to drive a tractor in a storm gets struck by lightening, man chooses to fly abroad and man makes bombs. It the man who creates these harmful yet useful items, but it at the hands of MAN who uses them for destruction. NOT your so called belief that God is at the center of all forms of evil. This is where you have a choice of free will.. Do you choose to put a man made bullet in a chamber and point the gun.. God did not do that.. You did. Did got tell you to get on that that plane to fly to visit your family and only to find a terrorist on board? No you did, and he is the one who made a choice to arm himself with bombs or the air traffic controller who nodded off instead of watching his control to avoid a collision, or the maintenance man who skipped a vital detail in his duties, or even the manufactures who used sub standard equipment. It is the child or family members who fault for their death or dying body or God fault for this? The first thing people want to do is blame God.. Why would he not stop it.. How can anyone stop man with their choices unless they first look to God for his life for answers? To make right and wrong choices, and place their faith in him first and foremost (at least for me that is ) You see those children in the hospital continue to go through more suffering from the medications they receive as not being natural to the human body that was created by god. While I do not have answers for ALL or every part of the why’s things happen and who they happen too.. I do know some how there was a reason for it. Now lets address this other issue. Your faith.. Hold on.. I am not trying to convert you.. cause good lord knows that I not what I do.. However to help better understand you, you said you ONCE was a believer. You were brought to those depths of hell to consider suicide. I do not know if this is the reason and quiet personally that is between you and God as to why you turned your back on him and belief. With that said, you mentioned why he would bring you to such depths of suicide and asking for answers to the others who were prospering from such.. (sorry I am not good at quoting)… Again, you did not commit suicide (I too have been there.. by medication and no not illegal drugs but those administered for blood pressure) First before you place blame.. seek inside your self and what was happening during that time.. Were you, and I do mean you. Where you in the right place with the faith in God at the time? Or did you just call upon him for answers to the woes you were facing. Now maybe you did have such faith that when you bowed to your knees and did not get any answers, but how often did you really put your faith in him.. Or was it only for your convenience? Keep these thoughts in mind. Remember back when. What it was that you lacked? You see I mentioned I too was suicidal, when I was given a blood pressure med from a doctor along with them destroying my thyroid when I placed my faith in the physicians to know all.. The combination was horrible, and a very strong avid Christian by faith swore that Satan can take my family, strike me dead but he could never take my faith in God that he could not have me.. Well guess what, I repeated those words shortly after wanting my life to end, (a mother of three) and it dawned on me.. what he did.. He attempted to get to me through my mind after all and almost succeeded until I realized it.. I found a renewed faith and determination. I also sought out the why’s and corrected them. Sometimes things are a little too late but one thing that is not, ever to late is God. He is there always, he just wishes more people would believe.. As far a miracles, many have been written, they come is doses that usually no one can recognize them so they really are all around you and effecting your life on a daily basis, sometimes you just have to wake up and take things are not always based on provable fact! Best wishes to all those who managed to read this.. One last input.. Those words that were written over 2000 years ago by sheep herders and fisherman.. are the very words that make up our US judicial system even to this day, and our medical practice system. One can not stand by and say they are a truth atheist as there is good and evil in everyone, it is choice you make because everything good is to come from god and foundation he laid upon mankind to have this free will of choice.. If you choose to follow morals and man laws and right from wrong you are choosing to follow God laws. So in my mind you are not an atheist, no one is.. unless you have total evil hatred for mankind. (Some folks just kind hide their faith as a defiance for proof they may never get) If you were a fly on a wall, you will hear more and more Doctors offer their services, but to advise spiritual, and alternative healing techniques and properties for such issues as cancers, tumors, etc.. I know last week my mom was determined to have stage three small cell lung cancer, so with radiation, chemo and alternatives are being used along with the power of the holy one guiding her through the process. To explain, I have faith in Doctors as does she, she elected to treat the outside in,, all the while treating the inside out.. One blast of what scientific radical approach is suppose to be supportive is all they will get as God did give man knowledge, after that she will be handed over to god for his healing inside out with the healing properties of the earth, Flax seed oil, bitter apricot seed, teas, asparagus, berries, celery.. All grown naturally. Best wishes to all..

            31. Oh Lordy! I have to keep on so no one misunderstand me.. Clearly I am no scholar, and further not educated.. but please also understand I do not hold any ones else’s faith or religion lesser than my own.. My faith is Christianity. I do not shun my nose into the air and hatred towards anyone who has their belief in any other religion. The truth be told, most religions believe in “ONE” higher power no matter who you may call him or it.. I will not say mine if better or superior to anther as I am not placed here on earth as a judge and I sure hope I have not come off as one. I have merely stated my (what may some may consider) narrow minded input.

            32. Tricia: “Nothing anyone can say or do can take away my faith in Christ or God or anything to do with my Christianity.”
              And this is why you are a fool, choosing choosing to believe whatever you want no matter what contrary evidence comes your way. An ostrich with her head in in the sand, a child putting her fingers in her ears saying “LA LA LA, I can’t hear you!” That is the nature of faith.

            33. The placebo effect suggests that if you believe something will work, it tends to work better than if you lack such belief. There is nothing wrong with people praying in addition to taking other active steps to cure diseases (so long as they do not use prayer as a substitute for undertaking scientifically valid steps). It certainly will not hurt (provided they are still doing the other activities that we know based on scientific evidence will help). As to your point, though, I think it is better to realize that prayer was never meant to be a “hotline to heaven”. It reminds me of a joke: God answers all prayers. Occasionally he says yes. Often he says no. But usually he responds with you have got to be kidding.

              So how does he “answer” prayers? Well, the way to think of it is simple: he doesn’t. If God regularly interfered with the world, it would become readily apparent that there actually IS a God. This proof would instantly destroy faith since when we do not have faith EXCEPT when there is no proof. I don’t have faith that if I walk off a ledge, I will fall. I KNOW that I will fall because of this thing called gravity.

              The problem is most religious people claim absolute knowledge that there is a God and that means that they are going around demanding proof. Since they are so desirous of that knowledge, they invent the proof and thus deny faith, which ultimately means that they destroy the very basis that they themselves argue will save them. The only way to reconcile this and to still be a believer is to be an agnostic theist, which is what I am and since one cannot claim knowledge of the nonexistence of something, the only rational position of the atheist is to also be an agnostic.

            34. I agree with you on this one. Prayer won’t hurt as long as people are using the tools of science also. My point is that prayer won’t help either. It is the zero that can be factored out of the equation.

              Interestingly enough, praying to a milk jug also yields the same results. Milk jugs answer prayers in the form of yes, no, and wait too.

              I am an agnostic atheist. Most atheists are.

            35. You are incorrect about the effect of praying to a milk jug UNLESS you are a milkjugitarian (a believer that God is a milk jug). Scientific studies *do* show that the placebo effect does indeed work with regard to self-prayer. It doesn’t work on praying for others though unless the others know that they are having someone pray for them. It also only works for those who actually believe. I think in the case of atheists, you would simply believe that you can will yourself back to health and it would accomplish the same thing as the believer’s prayer to God.

              In any case, I think that it is ridiculous to argue over whether God exists (since we cannot know whether He exists or not–I believe, you do not, que sera sera) and I do not understand why theists even care if you are an atheist. I am not an atheist and it doesn’t hurt atheists that I am a theist, so why should I care if you are an atheist, so long as we both agree to not impose our views on others through the collective power of government or other means of force.

              I think that the fear among theists is that atheists will attempt to impose atheism a la what happened in some communist countries. But that is the product of communism, not atheism. Similarly, the problem of religion is NOT the belief in God. The problem of religion is that it is organized religion and that is what breeds the intolerance. If people would treat religion as a personal thing and not try to convert others, things would be much better. Indeed, God Himself suggests the same. With organized religion, we substitute the belief of the group over our own understanding of scripture. This is not what was ever desired or purported to be proper by God. Indeed, a proper reading of the Bible suggests that the founding of the Church was not what Jesus (peace by upon him) intended since he founded no Church during his days on Earth. Nor was today’s organized system surrounding Islam desired by Muhammad (peace by upon him) since the Caliphate was transformed into a corrupt hereditary system after the death of Ali in 661 AD rather than the version that was run under the four rightly guided caliphs. As Abu Bakr (peace be upon him) said when he became the first caliph in 632 AD:

              “The weak among you shall be strong with me until their rights have been vindicated; and the strong among you shall he weak with me until, if the Lord wills, I have taken what is due from them… Obey me as long as I obey God and His Messenger. When I disobey Him and His Prophet, then obey me not.”

              Notice the emphasis on personal interpretation rather than organized interpretation implicit in this statement.

              My grandfather (an Islamic scholar, peace be upon him) taught me that we simply do not know what happens to atheists after they die and, in fact, to state that they will go to hell is to place ourselves in the position of being God (a similar argument can be found in the Bible where Jesus says, “Let one among you who is without sin cast the first stone” as well as “Judge not lest thee be judged”). If Christians (and Muslims) took these sentiments to heart, the world would be a far better place for all concerned.

              I think that what happens after we die is that we are judged in the sight of God. Since at that time we will know for certain who is God (for He will be appearing right before us), we either will accept His judgment or argue with him. From what I have seen from many Christians and Muslims, they will argue with God if He tells them to go to hell. That would be the only unpardonable sin from my way of thinking. I have a sneaky suspicion that many of you atheists would obey God if he were in front of you and told you to go to hell — that would be the way to ensure that you are called back since it is a test of your REAL faith.
              Of course, I could be wrong and there may be no God but I still take comfort in the end that I am righteously guided, as I believe you are as well, because I use rational interpretation (Ijtihad) as well as following my inherent natural sense of right and wrong (fitrah) over blind literal readings of scripture that can lead to evil. The devil never found a better audience than unthinking masses congregated in a house of God.

              Peace be upon you. Your talk is not dangerous talk, dangeroustalk, even for the believer, for what you are claiming is closer to God’s truth than what most purport His truth to be.

            36. Cute but that is not what I was referring to. You and I agree that God really doesn’t interfere with mankind (as I pointed out the yes, no, and you’ve got to be kidding was a joke). I was referring to the placebo effect in medicine. Praying to a milk jug cannot cause the placebo effect unless you BELIEVE that the milk jug is God (or can otherwise make you better). The reason that placebos work is because people THINK that it will work. I give you a sugar pill and then tell you that it actually is a wonderful medicine. Self-prayer works the same way when it comes to medicine (it becomes a rationalizing mechanism when it comes to everything else). The milk jug can always be a rationalizing mechanism (just like the lucky rabbit’s foot) but it cannot cause your body to subconsciously heal itself (the placebo effect) unless you actually believe it can do so.

            37. There have actually been studies on the affect of prayer. While some studies have shown a slight placebo effect in the positive direction, some studies have actually shown that those prayed for got worse do to the placebo effect. Most have shown that prayer does nothing at all and that there was no noticeable placebo effect.

              No matter how you want to slice it, it is clear that prayer does not have an affect that God answers it. At best, we are just talking about tricking the mind. There is no supernatural cure that prayer provides. Can we agree on that?

            38. To my knowledge, the studies on the effect of prayer that show a negative effect in some cases are based on intercessory prayer, not self-prayer. Intercessory prayer has been shown to be completely ineffective when the subject does not know that he or she is being prayed for (and there was one study that showed people got worse but it cannot be due to the placebo effect since they did not know that they were being prayed for).

              When people know they are being prayed for, the effects are mixed. It is much more difficult to do a scientific study on self-prayer so we default to knowledge of the placebo effect and use the findings of that in order to determine the effects of self-prayer and the findings are that prayer is useful BUT it is useful just like meditation and even laughter is useful. It is a mechanism for us to heal ourselves. As I have repeatedly pointed out, there is no evidence of a supernatural cure (I will not go so far as to say that there is no supernatural cure that prayer provides but that isn’t why self-prayer is useful). Self-prayer is useful because of the placebo effect. You keep mistaking me for someone who believes that God interferes in our lives. I have stated repeatedly that I do not view God as interfering in our lives (and that includes granting prayers) since any perceivable supernatural action (and that would include evidence of supernatural cures) would destroy faith by providing proof.

              Believers should not try to convert non-believers to their cause anymore than I should try to convince you that Miss Oregon is prettier than Miss Virginia. However, the same is true for non-believers with respect to believers. Belief (and nonbelief) in God is not something that you can rationally explain anymore than whether one beauty contestant is more beautiful than another. What nonbelievers CAN do (and OUGHT to do) is convince believers not to be part of ORGANIZED religion in the sense that they uncritically follow the opinions of someone else with regard to what is the meaning of scripture. It is the blind obedience to literalism (or any other interpretive method that goes beyond the individual himself or herself) that is at the heart of all problems with regard to religion. Indeed, the argument is one that can be made for the believer even from within the religion itself. After all, if you follow another’s interpretation of your scripture (and literalism *is* following another’s interpretation just as much as any other dogmatic method is), you have made that person (or method of interpretation) your God and that is denying the true divine. The problem is not God and it is not scripture anymore than we have a problem with knives because someone used them to kill 30 people in China yesterday. No, both God and scripture are simply tools from the perspective of man. Tools that can be used for good OR for evil. The problem is that man has used the idea of God and scripture as a weapon to hurt his fellow man. Take away religion and you simply will have another weapon that people will use to control their fellow man (nationalism, communism, fascism, totalitarianism, etc.).

            39. Then on the issue of the placebo, we have no disagreement. But as you correctly pointed out, meditation is just as effective. Still, the placebo affect only goes so far. It won’t cure cancer. It may help in conjunction with medical treatment, but no amount of praying or meditation will cure it to our knowledge. So rather than have people believe that prayer works that they stop seeking medical intervention in favor of God while sending $72 to a snake oil salesman, I would think it is better to let them know that there are no supernatural cures through prayer and that they should not give their money to this fraud and instead seek actual medical attention.

              As for persuasion. I see nothing wrong with anyone trying to persuade competent adults in sound mind, of their point of view. Hell, you are trying to persuade me of something right now and that’s cool. The issue with persuasion comes in when people try to take advantage of others who are not in their right mind or are not mentally competent. For example, preaching religion to children is not cool. Children do not have the ability to understand and might not be have the mental capacity to argue back. Another example, preying on people when they are emotionally vulnerable, like after a friend of family member has just died or when they are at their lowest point due to some form of physical addiction (drugs or alcohol). That’s not cool.

              But you seem like you are emotionally stable and an intelligent fellow. So I have no problem trying to persuade you that your belief in a deity is wrong. I am in an emotionally stable position at the moment too, so if you want to convince me that Allah is real, have at it. Give me your best argument. Show me your best evidence.

              I don’t think trying to persuade people in and of itself is a bad thing… especially when I think that the thing that they believe is dangerous to themselves and others. I do think religious belief is dangerous. I think it is a threat to human happiness, human progress, and human survival. When people see faith as equal or better than reason, then there is a serious danger factor and I will try to persuade those people that they are wrong. But I will do it while respecting them as people and not by waiting until they are at their weakest moment to prey on them like so many religious believers do.

            40. I don’t try to convince you as to whether Allah is real or not. I wouldn’t convince you of it nor should I even try because it is futile. I might as well try to convince you that Coca-Cola is better than Pepsi-Cola. The same would be said of you trying to convince me. I have tasted both Coca-Cola and Pepsi-Cola and I can tell you in no uncertain terms that Coca-Cola is the best FOR ME. Just as belief in God is superior to non-belief for me. For you it is the opposite. Just as I would not desire to kill you, imprison you, force you, or even convince you of the superiority of Coca-Cola over Pepsi-Cola, I also do not try to do the same for Islam. What I do hope to convince you of is that you are chasing the wrong goal when you think that religion is inherently evil. You are making a serious mistake in your thinking process because you fail to see organized religion is simply a tool for social control, one that can be channeled towards good or evil depending on who wields it.

              As a libertarian agnostic Muslim, I disdain organized religion, not because it is bad per se (for it is not) but rather because it congregates too much power in the hands of too few. At the same time, I see nothing at all wrong with personal religion (or non-religion) as the case may be provided it is personal in nature. After all, science can become dogmatic as well and there are certain things that scientists take on faith (called axioms) because they believe them to be self-evident (rather like God to the religious). The good thing about science is that it tends to abandon or modify axioms when they are shown to be in error. The bad thing about literalist religious people is that they tend to double down on their own errors when they are to be in error.

              As mankind has learned more about the world, the ability to invoke God to explain things has diminished. But that is the critical error that so many have made. By presuming we need to explain things using God, we attempt to create proofs of God’s existence. If we could prove God existed, He would not be, since it would destroy faith.

              I do disagree with you about teaching religion to children. They do need to be exposed to it but it needs to be with the idea of tolerance and acceptance. I take my children to the local Unitarian Universalist congregation. There they are exposed to a wide variety of viewpoints, including atheism (there are a lot of Unitarian Universalists who are atheists). I also tell them that I believe that there is a God but that God does not interfere in our lives. When we pray to Him, we are not asking for him to do things for us. Only we can do things for ourselves. Prayer is simply an acknowledgement that there is more to the universe than any of us could ever hope to understand and prayer is only of benefit to ourselves when we action comes out of it. God will not respond to you but prayer gives you a realization that you are part of something bigger and is more about having a conversation with yourself and the divine that exists within each of us than attempting to reach the creator of the universe.

              I also point out that I may be wrong and that not everyone believes in God and that’s okay as well. What is important is to be a good person. I therefore also disagree with you with regard to religious belief. It is NOT religious belief that is dangerous. It is the uncritical examination of religion and allowing others to tell you what to believe that is dangerous. When you allow anyone to tell you what to believe and you agree with them uncritically, you make them your god. Religious belief per se is not a threat to human happiness, human progress or human survival. It is when people substitute faith for reason that it becomes a problem. However, when there is no reasonable option available, I see nothing wrong with faith. I have come face to face with death before. I had no means by which I could guarantee my safety. I had faith in my fellow human beings that they would find me and get me to safety. I also have faith in myself that I will live to see another day.

              This is really what originally Muslims meant when we say “Inshallah”, which means “God willing”. As my grandfather (PBUH) told me, God does not work by magic or miracle, He works through man. If you have faith in God, have faith in your fellow man, for that is the only miracle you will ever see on this Earth. If you lack faith in your fellow man, you have no faith in God either. I would think that you would agree with me that this type of faith (not in God but rather in ourselves and in our fellow man and woman) is a good thing.

              I would also hope that we can both agree that the government should not impose a religious faith on the people and it should also not require that people have no faith. Both policies are bad. I may be a Muslim but I can see nothing worse than a theistic state because it multiplies the power of the state a hundredfold. At the same time I would not want to live under a state that outlawed religion because that is merely one additional step towards trying to control all of our thoughts.

              If you try to force people to be good, you will end up with very evil consequences.

            41. Ok “Dangerous” after reading all the way down to this I found my answer to my very first question to YOU. Now I would like to respond to the statement YOU made here in regards to an AGNOSTIC ATHEIST.

              FIRST, you can’t be both, they have different defenitions.

              Atheist, agnostic, Infidel, Skeptic refer to persons not inclined toward religious belief or a particular form of religious belief.

              An Atheist is one who denies the existence of a deity or of divine beings.
              An Agnostic is one who believes it impossible to know anything about God or about the creation of the universe and refrains from commitment to any religious doctrine.
              An Infidel means an unbeliever, especially a nonbeliever in Islam or Christianity.
              A Skeptic doubts and is critical of all accepted doctrines and creeds.

              As an Atheist there is no existence so there is nothing to know. Because it doesn’t exist.
              As an Agnostic it exists, but it’s impossible to know about it because it is beyond our capabilities to know.
              As an Infidel you’re an Atheist.
              As a Skeptic you’re an Agnostic.

              Now if you’re saying that YOU believe it’s impossible to know GOD (physically, which is true) so therefore YOU don’t believe he (GOD)
              exists, that would explain the confusion of being two contradicting things. One that believes but isn’t capable, and one that just doesn’t believe at all.

              My other question if you will, is…What election was held where YOU get to speak for the MAJORITY of the Atheists in the world? A couple of my family & friends might have an issue with that, LOL! IJS. I mean unless YOU have walked the ENTIRE earth & got written permission (the facts) from those who claim Atheism & Agnostism, your claim is not accurate, in…My Opinion.
              I would like to say that I’m not trying to be insulting so if it is received that way, oh well, that wasn’t the intent. I just like to delivery my comments with what I call wit. Which by the way you have. Although it may at times be, to some, insulting. I appreciate it, because if nothing else it’s at least honest.
              Finally Thank You for this forum. I found info on the Bible Cancer Cure that somewhat answered my question about the website being a ploy to make money on the misfortune of others. I really do appreciate YOU for having this. I applaud you, regardless of what YOU believe or don’t believe.

            42. Rodd, you are repeating the same narrow Christian definitions that I learned when I was a kid. Most Most atheists I know are agnostic atheists, which is not the same as just agnostic. An atheist simply does not believe in any gods, a gnostic atheist claims this can be known with certainty, an agnostic atheist recognizes that the existence of any gods is a negative that can not be disproven, but is pretty sure there are no gods. I am an agnostic atheist. I don’t believe in leprechauns either, but if evidence for a god or leprechauns shows up up tomorrow, I will reevaluate my position based on that evidence.

            43. Praying to a milk jug will not give you a placebo effect, so it does not yield the same results. That is, unless you believe that praying to a milk jug will work. This is why atheism is so dangerous for those who believe (note it is perfectly fine for those who never believed). It destroys the positive placebo effect of self-prayers and replaces that with . . . nothing.

            44. No, it replaces it with meditation… which does work! God belief is dangerous because it replaces actual medicine with just the placebo effect (like what this article is actually about!).

            45. Wrong! You don’t understand what prayer is or how it heals the body. Prayer REQUIRES belief that it will work (just like ALL placebo effects work). If you don’t believe it will work, it will not work. That’s why it is called the placebo effect (where the person actually believes it will work).

              An atheist does not believe that the milk jug can answer prayers. Therefore, prayers to a milk jug do nothing. An atheist might believe in the power of meditation. In such cases, meditation will do something but prayer, for the atheist, by definition, does NOTHING. It is only meditation (which is not the same thing as prayer although the end result is the same when prayer is practiced by believers) that works.

              For the believer who does not believe in meditation unless it is prayer (and most don’t), atheism is dangerous. God belief works. Note that it works regardless of whether God actually is there. The point is that prayer is good for you.

              As for your next point (that God belief replaces actual medicine with just the placebo) that isn’t true and it isn’t a proper comparison to my complaint about converting believers to atheism. I never stated that atheism removed medicine. A person who does not believe that modern medicine will work will not be as well off as a person who does (after all, they won’t take the medicine then!). Yet mere God belief in no way shape or form suggests that one should not engage listen to doctors.

              Your complaint is specific to certain religious practices that are dangerous (on that we can both agree). However, to indict all of religion for the practices of some is to engage in a logical fallacy. Sorry, God belief is NOT dangerous. Certain religious practices CERTAINLY are. Stop making the erroneous logical leap (that you always seem to do) that believe in God is bad simply because some practices of worshippers are bad. Your logical fallacy is clear when we see the atheist Communist fallacy: if I were to say that atheism is bad because some atheists are Communists that isn’t an indictment against ALL atheists. It is an indictment against SOME atheists. Remember also that I don’t have a problem with you being an atheist. I have a problem with you trying to convert others to your cause by pretending that you have facts on your side when all you have are opinions (and it is for that reason that I never try to convert you to my side since all I have are opinions).

            46. I would agree with the first point. God does not grant miracles. Prayer is dictated for your own personal use (it is basically meditation plus a placebo effect). However, I would qualify the second point: medicine works regardless of whether you believe it will work or not provided you follow your doctor’s directions and take it as directed . Thus, you absolutely have to believe that it will work (or at least not believe that it won’t work) since if you don’t believe it will work, you won’t take it (this is assuming that you have a choice about taking it — sometimes it is forced into your system or you are given it without realizing it and then it just works as directed).

            47. Well, actually, we’re all going to die. I’m pretty sure that’s a scientific fact. However, where we end up is determined by how we freely choose to live while on Earth.

            48. Just as a side question, is hell isothermic endothermic or exothermic and are there any engineers in hell

            49. What is that inaudible context you recognize when you write discourse such as this? Just asking.

            50. No shit. IF there is a god the first thing I’ll do when I see him/her is punch him/her in the mouth for the 15 million kids he lets starve every year. And don’t blame “free will” as he/she/it created that too. Plus, what free will does a starving 2 yr. old have???? It’s total bullshit.

            51. Tactical111…..How many starving children did you help feed, today? Why are you waiting for God to do it? Are you ready for your face to be punched for those 15 million starving kids YOU DID NOTHING ABOUT?

            52. Maybe God wants you to be the one to help some of those 15 million kids. And if there is no God, then why don’t you help them anyway?

            53. I can’t speak for Tactical111, but as for me, I do try to help those who have no food. I don’t have enough food to help 15 million kids, but I can and do support secular organizations who try to feed and improve the lives of everyone. More than that, I try to help the roughly 5 to 6 billion people who have been infected with the virus of Abrahamic religions. Maybe if religious believers would spend less time and money worshiping your deity of choice and more time and money helping your fellow human beings, the world would be a much better place. Stop living for an afterlife and start living for the current life. Sarah Silverman put it best when she said, “Sell the Vatican, feed the world.”

            54. Well said DT. There is a lot of money wasted on religion. There is a lot of money wasted in the secular world as well. Please understand, I am not a religionist. I do not believe in a religion. I believe in God and Christ His Son who taught us, God, others, self.
              Just as you do, my family and I, including my 2 teenage sons work in our community to help feed and clothe the poor, adults and children, either through our church or on our own.

              As far as religion is concerned, I religiously brush my teeth everyday, go to work, bathe, etc. That is the only religion I really support.

            55. Right, because Christianity isn’t a religion, but atheism is. I’ve heard that one before too. I hate to be the one to tell you this, but if you believe in a deity, then you are religious! That’s pretty much the definition of the term. But at least you realize that religion is a bad thing. That is progress. But you are a Christian and Christianity is a religion. So please recognize that you are part of a religion and that is not a good thing.

              Yes, money is wasted by everyone, but religion wastes a lot of money swindling good people like yourself. Maybe someday pastors will be required to announce that everything they say is for “entertainment purposes only” just like psychics, but for now it is still a scam. A tax exempt scam too, I might add. Your church is actually taking money from me and my family. We have to pay more in taxes because your church won’t pay it’s fair share. Strange for people who claim to follow Jesus who repeatedly told his followers to give away all their money to horde all their money, don’t you think?

            56. Actually, I never said atheism is a religion. And I used to be religious, but now I follow Christ and his teaching. I go to a church on Sunday where I socialize with people who are of like mind. However, the organized religions, Baptism, Methodist, etc. play no part in my belief. In fact, they are the catalyst that sends people into non-belief. And sadly, some preachers are nothing but entertainers but to group all together because of the actions of few is a little close minded.

            57. You are a Non-denominational Christian. That is a religion. If you believe in a deity, then you are part of a religion. That is what the word “religion” means.

              All preachers are entertainers. They are storytellers preaching a made up story. Some are just better at it than others. Some are just more entertaining than others. Some are just more convincing than others. But unless any of them have any actual valid evidence for their claims, they are all just fiction-tellers. Prove me wrong. I’m open to it. Present some valid evidence.

            58. Well, then by that definition that would make atheism a religion as well. To believe that nothing is out there and live accordingly.

            59. Umm, I think you missed the part where you have to believe in a deity to be a religion. Again, the whole Christianity isn’t a religion, but atheism is a religion is just sort of silly, don’t you think? Besides, I’m not married to the label. So whatever you want to call a lack of religion, that would be me. 😉

            60. Well, this proves that it’s really the Christians who think they are better than Athiests, not the other way around. I saw a few accusations here about how Athiests supposedly think they are better than Christians because of their “facts”. LOL! That has never been the case, we are merely sad for our fellow man (friends, relatives) who are brainwashed by this mass delusion. And we hope that we can somehow get thru to some of them by way of reasoning – researching all the ins and outs….

              and yes, even researching the bible itself! The bible itself is proof enough that it’s not inspired of God. The sad truth is that Athiests tend to know more about the bible than many Christians do. I know, I used to be a devout Christian until a few years ago when I started reading the bible from beginning to end as an adult. I am so glad I did – my eyes are wide open now! I genuinely hope you can too. Don’t believe me? Check out evilbible.com for all the proof you can possibly handle – and you cannot dispute.

            61. On the contrary, I believe both sides of the debate are extremely condescending on these message boards. I too have read the Bible from cover to cover and found a beautiful love story. The cool thing about the Bible is that no matter how many times you read it, you can find something different each time. I know a woman who has read it front to back every year for many years and is still finding new things. :)

            62. So you think mass murder and genocide are “beautiful?” Jesus advocated that everyone deserves to be tortured for all eternity. This you find “beautiful?” I guess I have difference definition of that word.

            63. The book as a whole is a beautiful love story, yes. LOL That doesn’t mean that every individual story is beautiful. Uh, slaughtering entire cities, women, children, livestock. Not so pretty, no.

            64. Most of the book series is filled with the slaughter of cities, women, children, livestock, rape, smiting, advocating for slavery, advocating against women’s rights, more smiting, etc. Do you know how little the Bible talks about love? Even most of that talks about how we should love our dictator and slave master or he will torture us for all eternity. even the love ain’t pretty and it is pretty tough to make mess up love and yet the Bible manages to do it.

            65. I’m sorry that you see it that way. :( I wish you could see what I see, but I can’t make that happen. I see a lot of love of God for us, us for God, God trying to save us from the evil in the world…etc. The slaughter was of groups of people that were a threat to His people. I’m sure He didn’t enjoy it, but He was certainly going to defend His children. (Israel) If you care about tit-for-tat at all, the Jewish people have suffered a great deal since then. I guess that kind of makes up for their enemies being slaughtered in Bible times? Ha The world is a violent place. Kinda sucks a lot of the time.

            66. Well…let me just hop in here and address this. How do you know you believe in the “true god?” Shall you dismiss Vishnu, Raj, Thor, Apollo, Allah or any one of the other millions of gods out there?

              More importantly..what does your point have to do with anything whatsoever? It’s a lame appeal to consequence with no substance or reason to be granted any sort of credibility what so ever.

          2. Atheism simply inserts the individual in the place of God. You decide on morality. You decide what God should or should not be.

            Atheists fool themselves into believing they’re better than Christians, because they base everything on “facts,” not “faith.”

            Did it ever occur to you that you have simply replaced the Christian faith in God with faith in yourself?

            1. I have actually written several articles on morality in the Atheism 101 section of this website. You should check it out because you clearly have no idea what you are talking about and you might learn something.

              Yes, atheists base everything on facts not faith. You say that like it’s a bad thing. It isn’t.

            2. Really? When you say “when I get up tomorrow, I’m going to the…”. Wow, aren’t we the pretentious one? I would say that was FAITH making a statement like that.

            3. LOL!! “Atheists fool themselves into believing they’re better than Christians”…”…you clearly have no idea what you are talking about and you might learn something.”….Uh. Point proven. Thank you, proud atheist. That was cute. 😉

            4. Better and more knowledgeable about a particular subject are two different things. Are you claiming that anyone who claims to know more about a particular subject thinks that they are “better people?” I guess you think all educators think they are better people than all of their students? That’s a very distorted view of education. It’s also a very sad view.

            5. Oh no, there are plenty of educators who are humble and do not put their nose in the air so to speak in making statements like, “You clearly have no idea what you are talking about”. Your assumption is that more knowledge is better than more faith. And really, that’s to be expected because you cannot understand everything that faith brings to the table without actually having it. There is a wisdom that far exceeds book knowledge. And along with that wisdom comes a humble attitude that does not need to insult other people’s intelligence. Is that wisdom always utilized on discussion boards like this? Uh. No. LOL But nobody’s perfect. I just thought it was cute how your immediate response was to, in slightly nicer wording, tell her she was a clueless idiot. It made me giggle. :)

            6. I never said that!!!! You are making up stuff, putting it in my mouth, and then attacking me for saying it, when I didn’t say it. I never called anyone a “clueless idiot.” I did point out that a particular person was ignorant about the subject that he or she was talking about and then referred him or her to a place where they could educate themselves on the subject matter. BTW, that person called me a fool and accused all atheists of holding views that we don’t hold. Yet, you have not condemned that person for his or her statements at all. Instead, you accuse me of holding a view that I don’t hold. Like i said before, I don’t think education is a bad thing and I don’t think people who are more knowledgeable about a particular subject (regardless of what that subject is) are “better” people.

              I do however think that traits like knowledge, education, and wisdom are better than faith. I had faith once so I feel that I can speak on this subject from personal experience. It is always better to know! It is also always better to seek to know rather than to claim knowledge one does not have.

              You have been nothing but insulting and then you accuse me of being insulting when I have not been. I know you believe (on faith) that all atheists are horrible, evil, people and so I can forgive you for forcing that stereotype on me (since I am an atheist), but you should try to understand where I am coming from and have an actual conversation with me before turning me into the caricature you were told all atheists must be.

            7. LOL! Oh my gosh, wow. I can do that too. I never said that I believe all atheists are horrible, evil, people! Hello pot calling the kettle black. 😛 And I know you didn’t call her a clueless idiot. That’s why I said “in slightly kinder words”. Your exact words were “you clearly have no idea what you are talking about” = clueless. If you haven’t been insulting then neither have I. So there! (Can you tell I’m having fun with this?) hehe

            8. Yeah, she said, “Atheism simply inserts the individual in the place of God. You decide on morality. You decide what God should or should not be. Atheists fool themselves into believing they’re better than Christians, because they base everything on “facts,” not “faith.” Did it ever occur to you that you have simply replaced the Christian faith in God with faith in yourself?” Which is not only completely wrong, but insulting to all atheists. She made a gross generalization about all atheists that few if any atheists actually hold. To which I said, “you clearly have no idea what you are talking about.” In other words, I was pointing out her ignorance about atheists followed by a reference she could go to learn more about what atheists actually believe. You interpreted that as me calling her a “clueless idiot?” That isn’t even remotely what I said. She was insulting and called all atheists fools and yet you are attacking me for exposing her ignorance about what positions atheists actually hold and directing her to a place to learn more?

              I see how this game is played. Christians can insult and personally attack atheists, but when atheists attempt to defend ourselves with facts and actual evidence, you cry that you are being persecuted and that all atheists are just big meanies.

              There is an old Buddhist story about a Christian who came to a Buddhist Monk to a religious dialog. The Christian started talking about Jesus and how we are all evil sinners and only through Jesus can one be saved. The Monk cut in and asked if the Christian wanted some tea. The Christian thanked him and said he would. So the Monk started pouring the tea into the cup and didn’t stop even when the cup was full. The tea started spilling all over the table and the Christian jumped up and yelled to stop pouring. The Monk explained that like the tea cup, the Christian must empty his cup before the Monk is able to fill it again.

              Moral of the story, don’t come to a dialog and present a monologue. Come with an open mind and try to understand where someone is coming from before you spout your point of view. Don’t bring your preconceived stereotypes with you.

            9. Ah yes, I see your point. She was telling you what SHE thinks you believe, as if it was fact. I stand corrected on that point. You however have accused me of attacking you and I have in no way attacked you. I simply giggled at what appeared to be you proving her point.

              Again, I never said you called her a clueless idiot, don’t misquote me. I also never cried persecution or called you a big meany. I reserve “Big Meany” for my husband. He’s a pain in the arse. 😉

              I know where you’re coming from. You’re not the first atheist I’ve spoken to. You have every right to believe as you believe. I just wish that people could stop with the condescending attitude. We are 2 intelligent people with our own thoughts and minds. You have faith in your thing, I have faith in mine. There were people on here, not sure if you were one of them or not, saying stuff like, “We’re just trying to educate you because we feel sorry for you!” I mean, seriously? It’s just laughable.

              Oh! And for the record, the whole reason I came to this page to begin with…I totally agree with you that the Bible Code thing is B.S.

            10. Um “Dangerous” if you would be kind enough to re-read what you wrote (ALL of it), you will find that YOU & YOUR OWN words won’t stand up to your own scrutiny.
              I agree that attacking one another leads to NOTHING. Which in actuallty gives to the two of you being equal in having short comings, due to the insults that were thrown at one another.
              I would however, like to hear how saying that, “an atheist believes in himself and not GOD” is insulting. And I’m truly not trying to be argumentative. I earnestly want to hear your point of view. Based on your statement of Atheism, it seems that my defenition of Atheism seems to be limited. With that being said please (earnestly) enlighten me.

            11. Would someone care to explain what the mean by “an atheist believes in himself and not GOD”. I hear that phrase thrown around a lot but no one thought to clarify.

            12. I once was agnostic because I saw my parents struggling with their marriage. I decided it was all ‘a crutch’ and threw the baby out with the bath water. Luckily, something came along which was so negative, it made me choose to seek the Opposite. That is how I found a real, living God who gives our lives purpose and has a very warm spirit. I love, love, love it when that warm, positive, gentle spirit comes into a room where Christians are praying.. It is very cool and not at all a hallucinaction or hysteria. Once when we prayed very hard for a long time about a friend’s son who is addicted to opiates, when we all finally stopped praying, the warm stayed around in the room for quite some time. One of the young adults with us opened her eyes after prayer time and said, “Where WERE we?” My feelings exactly! And the doors that literally flew open in that young addicts life were truly amazing. It was a definite warmth & positivity and heightened energy that lingered for a long time!
              May sound boring to some, but DEFINITELY more exciting than television for me! Love it!

            13. Actually “Danderous” YOU were insulting. In the begining YOU said that YOU would ridicule those who believed in GOD. Here let me post the quote YOU wrote.
              “Weeeeee….look everyone – I’m an ATHEIST!! I don’t believe in anything and I’ll just be worm food after I die but before I go – I’ll ridicule everyone who has faith in God. Sure, I’m not helping anyone but it makes me feel better about my empty, unfulfilled life!”

              Now these ARE your words correct? I mean, this looks like words of self admission to me.
              Now whether you believe or not is YOUR CHOICE. I would however like to hear about your experience about your FAITH in GOD that didn’t meet up to your standards. I give respect to the FACT that you do have a story that we ALL could learn from. No judgement. I do think that alot can be learned from YOUR life experiences. Which would allow people the freedom to choose, and make their own decision, as to what they want to and don’t want to believe in.
              I will aslo say that the other party was insulting as well, which was not called for. Because if she is standing on the faith of believing in GOD then forgiveness is the first thing she was supposed to give, inspite of your insulting comments.
              I do not condone your comments but I don’t take it personal either.
              Once again let’s talk.

            14. Ummm… NO those weren’t my words!!! You were quoting the Christian who was insulting me and claiming that I was saying them and… insulting myself? *facepalm*

            15. ha! that is hilarious that Rodd screwed that up so bad! I think he should admit that but it has been 5 months so whatever. however, telling someone they, “have no idea what they are talking about” is a little insulting. It happens to be true for that flagirl336. also she was being much more insulting to you in the first place, but still. i think the real issue is that these marketeers are praying (no pun intended) on the weak people like, flagirl, michele, and especially Rodd.

              while i am not defending this scam of a book in any way, there is something to be said about fasting. fasting is a very healthy thing to do. im not saying do it for forty days, but when done in a responsible manner, it can have many health benefits. Im not gonna say that curing cancer is one of those benefits however. I would need more FACTS and EMPIRICAL EVIDENCE before i put any FAITH in that.

            16. Ok, woah, I barely even remember what we were discussing here because it’s been so long. I just jumped back on here and saw myself listed as “weak”. I am FAR from weak, Samson. I didn’t buy this book, nor would I have any interest in buying it. I simply commented on what “Dangerous” said because it cracked me up. I am a person of faith. Dangerous is not. My choice. His choice. Whatever floats your boat. I just found humor in what he said and he got all defensive which further fueled the ridiculousness of the conversation and I therefore left the conversation. I just happened to come across this in my email today so I thought I’d go back and see what I got myself into. LOL Believe what you want on any subject, but know that I am not weak. Thank you and good night. :)

            17. Samson, I think the word you’re going for is “preying, which is completely opposite of what you’re implying. The spelling is different, and it makes a big difference in meaning.

              Actually, though, it’s not weak people who know that the plants God put on earth for our benefit can heal diseases. Read my comment about the former surgeon turned natural therapist with a clinic in which thousands if not millions have had their cardiovascular disease reversed using those methods. I’m pretty sure he’s done more research in the natural field than he ever did in medical school, to learn the natural means of actually healing people rather than masking their maladies with expensive medicine.

              I guess the “facts” you claim to need before putting any faith in it is only of the type the medical community claim to have, whose methods cause other diseases that need to “treated” with other expensive medicines, thereby keeping them in a very lucrative business.

            18. Correction: The Christian who merely put you back in your place after you arrogantly attacked everyone who believes in God and/or practices healing means using the things He put on earth for us to use for that purpose. You started the whole scene with your insults. Put the onus where it belongs, squarely back on your own shoulders.

            19. For the record, my response to the Christian’s ridicule of me (that you quoted) was this:

              “Weeee… look at luckydc@gmail.com – He’s the guy ridiculing people who he falsely claims ridicule others and is too cowardly to sign his name.

              As for me, I criticize ridiculous beliefs because many of those beliefs are dangerous! This Bible cure for cancer is a perfect example. People with cancer should see a doctor instead of trying to find some hidden medical cure in a 2000 year-old book written by sheep herders.”

            20. Agreed, my grandmother was diagnosed with Cancer in 2008. It was a type of lymphoma that is usually easily treated with chemo and has a high success rate of remission when treated quickly. My grandmother, not a big fan of doctors and big pharma, tried several homeopathic clinics before trying chemo and by that point it was too late. Diagnosed in April and dead in October. I may not like the way that kids tend to be over-medicated for things like ADD and ADHD but cancer is not the same.

            21. That’s like saying basketball is stupid or wrong because the ball doesn’t go through the hoop everytime. Imagine if children wanted to say to their parents, “You’re not my parent because you told me no.” People dying have nothing to do with the existence of God. Death has to happen. God intervenes when it’s not time. Period.

            22. I should add that my husbands mother died in the same manner but did go straight to the doctor when she discovered her cancer. I believe that Cancer and it’s existence come from the fact that scientist are trying to “make” food and mimic what God created. It is giving us cancer. And just like you give kids rules and guidelines that they don’t readily follow – God does the same. Science is human’s lame attempt at being God.

            23. People like you said the same thing when people were dying from the plague, polio, smallpox, and many other illnesses. Doctors and scientists just haven’t figured out how to prevent and cure cancer… yet. But they will and then children and adults won’t die from cancer any more just like people don’t die from the Black Death any more. People used to believe that God punished people with leprosy, but you don’t see people dying from that anymore, do you? Wasn’t that God’s punishment for all the things you disagree with in society? I guess scientists and doctors really showed God. Think about it.

            24. No, I think yo missed the point. Death doesn’t have to happen. God is not a basketball. God is supposed to be all-powerful. If he doesn’t want death to happen, then death doesn’t have to happen. So either God wants death and suffering to happen or God doesn’t actually exist. If he wants death and suffering to happen, then he is a pretty malevolent deity and certainly not worth worshiping. But fortunately there is some great news and that is that God almost certainly doesn’t exist. Now go live your life!

            25. ??? God created you and just because YOU think it is inconvenient for someone to die doesn’t mean that it didn’t serve a purpose? Why look at death as a bad thing? It can help draw people together and possibly bring another to Christ. And heck, if that person was a believer and saved, well then they just made it to eternity a wee bit quicker than the rest of us God worshippers. He made everything and can take everything, He has every Divine right. You can thank Noah for approaching God and asking to spare just a smidgen of the human race if they turned from wickedness and repented and all that fun jazz. Also, oh wait, I guess since I don’t have any record of this other than an old book then it’s made up gibberish from some sheep herders right? I am sorry if no miracles happen often in modern day as a result of this world turning away from God. We have neglected Him so why should He make an appearance? No, not a literal appearance in case you were wondering. So quickly history is forgotten and labeled “fiction”. And again, since God doesn’t cater to your every desire of sparing everyone death, that doesn’t mean He is an evil murdering deity and will “let” people die just because. All things He does serve a purpose.

            26. Actually I went to the doctors over my colon cancer and was about to begin treatment when I went to church and stood in a prayer line God healed me without one treatment. Also my five week old baby was healed by God of sepsis. He was only in the hospital 3 days. I have the paperwork proving it. How do u explain that Mr. Atheist?

              But I do have to agree that these wackos claiming that secret messages in the bible will heal you if u pay them are making christians and God look pretty bad. God healed me and my son and it didn’t cost me a dime. Thats the way God works. :-)

            27. I’ll explain it quite easily, you’re a liar. The power of prayer has been tested time & time again & shown to be utterly useless. Of course it’s useless, why would god change ‘his plan’ just because you ask him to? How do you explain the fact that people of numerous faiths claim the same thing? Does your god heal Hindu’s too when they pray to Brahma? Prayer is nothing more than wish-thinking & serves no valid purpose. In fact it was shown in one study that the sick people who were being prayed for & knew they were being prayed for, actually came off worse. I guess more people must have been praying for them not to get better, is that how it work? Whoever receives the most prayers wins? The fact is, NOBODY knows what happens when we die, & ANYBODY who claims otherwise is a liar or delusional. The only reason you believe what you believe is because you were told to. If your parents were Hindu’s you’d be making the same claims about Shiva & Ganesh etc.

            28. Oh. I guess u need to tell the doctors that gave me the papers that. Lol. Ur wrong. But u will find that out in judgement one day. Sad that u chose that route.

            29. Apparently I missed something i thought i was talking to adults? That sounded more like my 3 year old trying to make somebody mad. Well just in case you were wondering…it didn’t. Lol. These are posts to state our opinions right? Thats what I did. Im not looking for a fight, just telling my side of the story. :-)

            30. No, I don’t think JosephS was trying to make you mad, although calling him a three-year-old is just a little insulting. I do think he was making a really good point. You don’t really know how your cancer went into remission. You credit your deity for that, but it could have been some other deity. It could have been unicorns or some herbal concoction you got from a health food store. But most likely, your cancer went into remission on its own. We don’t really know why cancer does that (to my knowledge). Maybe it was diet and exercise or who knows what. But I think we can safely rule out magic. Just as we can safely rule out deities. If you want to ascribe a deity to your remission, how do you know which one? How can you rule out the use of magic? For all you know, one of the nurses could have been a witch and decided to cast a magic spell that put your cancer into remission. You can’t rule it out.

            31. #1 i said he is acting LIKE my 3 year old. Same traits. #2. ctually I can. I pleed the blood of jesus over my body. No demon in hell wants me healed, thats for sure. How do I know it was God? Since you asked, I was bleeding blood clots the size of of tennis ball from my colon, and in severe pain. I limped my way up to the front of the church holding my side, crying asking for God to send me some relief. A woman that was praying for me went and got an ink pen and wrote the time 8:23pm on it and took it to the preachers wife and told her she didn’t know why God

            32. You aren’t really helping your cause. 1. You compared him to a 3-year-old in an insulting manner. You intention was to insult him personally.

              2. So the answer is no. You have no idea how your cancer went into remission. That’s fine, no one does. But I take objection to your claims that you know what you do not know. That is arrogance. There is no shame in admitting that you don’t know why your cancer went into remission. Admitting ignorance is the first step toward wisdom.

            33. Had her to write it down. I stood up there praying for 10 min. When it hit that time, the holy ghost fell, I began to speak in tongues and shout everywhere. I fell in the floor “sleeping” (aka slain in the spirit) for just a few minutes. When I got up I had no more pain or bleeding! It is still gone almost two years later. You are gonna say I am lying and thats ok but I know the truth and down deep inside others do too.

            34. No one said you were lying, just that you mistakenly attributed a causal relationship that didn’t actually exist. Think about this, a thief believes everyone steals.

            35. If you dont believe what I am saying is true, then you are saying im lying. Either im lying and it didn’t happen or im telling the truth and it did happen. Thats really the only two options.
              I by no means am saying you deserve being eternally tortured. I dont want anybody to go there. Thats why I am on here trying to get people to reconsider dooming themselves to Hell. I have not told anybody to go there. It bothers my mind to think that Hitler is there. It’s horrible. I have close family that wasn’t saved when they died and theyre there. Did I think they deserve it? NO! Do I think God wasunjust or unfair for ssending them there? No. It was there own choice. They were given a chance to repent, just like you are being given right now. Have you ever thought about checking out “answers from genesis?”

            36. Elizabeth, you have put a lot on the table and I really want to address these points because I think they are important. I think you are good enough, smart enough, and gosh darn it, I you deserve better.

              You seem to think that is something isn’t true than it must be a lie. You seem to think that these are “really the only two options.” I disagree. far from it. Someone can be mistaken without intentionally trying to decieve others. That is the case here. You are telling the truth from your point of view. To quote Obi Wan Kenobi, “you are going to find that many of the truths we cling to depend greatly on our own points of view.”

              I think you are mistaken about the cause of your remission. There is an old documentary from the 70s called “MarJoe” about a very young preacher of the same name. He started preaching as a boy. The documentary is of him as a teenager still on the preaching circuit. He does faith healing and everything. The interesting part is that behind the scenes he talks about how it is all bullshit and that it is just a show. He no longer believes any of it, but the pay is awesome. He’s a celebrity and he loved it. It’s worth the time to check out.

              Like I said, no one knows why cancer goes into remission. So I 100% believe that you are telling the truth that you prayed and had a strong emotional experience. However, I think you are wrong (not lying) in ascribing this event to your remission. As pointed out, someone could have cast a healing spell on you and then your cancer went into remission. This doesn’t prove that the magic spell worked, it’s just two events that occur within a short time of each other.

              Now on to torture. According to your beliefs, God is all-powerful and he will judge people on judgement day based on critirea he created and if found guilty, they will be punshed in a manner of God’s design. Therefore, it follows that if someone is eternally tortured, it is because God believes they deserve it. In fact, that is the whole message of Christianity. We all are evil sinners who deserve to be tortured for all eternity but are only saved through the grace of God alone. So either you believe that the character of God as portrayed in the Bible is correct and that we all deserve to be tortured for all eternity, or you think God is incorrect and that people don’t deserve to be tortured for all eternity.

              Fortunately, I have some great news for you. Hell is imaginary too. Sin in am imaginary disease. Jesus in an imaginary cure, and God doesn’t exist. However, even if God were real he would still be wrong. No one deserves to be tortured. Not for five minutes and certainly not for all eternity without the possibility of repreave or parole. The idea that someone could be punished for eternity for finite transgressions is silly and dangerous.

              Oh, and according to God’s rules, Hitler is actually in Heaven because he swore his allegence to Jesus Christ, his lord and savor… while the Jews he murdered in ovens are cooking now and forever in Hell because they did not repent for their sin of not believing Jesus was lord. Remember, according to your belief, we all are evil sinners who deserve to be tortured for all eternity and are only saved by grace alone. No one goes to the Father except through Jesus. This is divine justice.

              Personally, I have no choice but to follow the evidence. My brian is wired that way. I can no more believe in the ridiculousness of the Christian system on insuficient evidence than I can believe that the world of Harry Potter is real on insufficent evidence. If your God is all-knowing, then he would know that. If he is all-powerful, then he would be able to present sufficent evidence of his existence. If we is all loving, then he would desire to present that evidence. So why am I still an atheist? Think about it.

            37. I believe you Are an atheist because at this point you are not willing to admit that you were wrong. I believe that you are feeling Gods conviction deal with you as we speak. You may not recognize it but I am praying one day that the words I say will echo in your mind and maybe set a spark to your world view changing. Think of the lives you could reach with your background and your ability to comprehend the things you do. I believe you could make a difference. Obviously you know the bible (even tho u are trying to make it a lie). Hitler did not go to Heaven. He murdered. Just because he claimed Jesus Christ was his savior doesn’t mean he really was. As is the otheran you described. Sad that men do things like that. I dont believe those people are really healed. A few may be but that is through there faith. I believe my work here is done. Just remember that a lil 23 year old girl is praying for you and dont want to see u wind up in hell

            38. Elizabeth, have you looked in the mirror lately? I once believed in God and all that, but I was wrong. I can easily admit that I was wrong. I might be wrong today, but the evidence currently doesn’t swing that way. Like I said, I would change my mind in a second and believe God exists if he presented valid evidence to me of his existence. I pointed out to you that if he exists, he would know how to convince me, he would have the power convince me, and he would have the desire to convince me. Yet I remain unconvinced. That tells me something. It tells me that God doesn’t actually exist. But hey, I could be wrong. My question is, can you be wrong? Maybe you are mistaken about the cause of your cancer’s remission? Is that possible? Not only is it possible, I think it is also probable. Just as I dismiss the idea that someone might have cast a magic healing spell on you as improbable. Could that have happened? Maybe. Either one of us can rule out a witch in the medical ward with absolute certainty, but as possibilities go, that one is pretty weak. Wouldn’t you agree?

              Hitler was a mass murder, but isn’t one of the things about Christianity is that anyone can be redeemed? Paul was a mass murderer too and yet he later became the writer of nearly half the New Testament. Are you saying that Hitler, who was a devout Christian, could not be redeemed? What about the Jews Hitler threw in the overs? They rejected the claim that Jesus was Lord. Do you believe they are currently being tortured for all eternity?

              Now let me ask you this. Hitler tortured the Jews for days, weeks, months, maybe even years. He is clearly a monster. God created a system in which those very same Jews will be tortured for all eternity. God has the power to stop their torture and put an end to the system he created, but he does nothing and those Jews will continue to be tortured, not for a day, or a week, or a month, or for a year, but for the next hundred years, the next thousand years, the next million years, the next billion years all because they didn’t believe Jesus was their Lord and savior. Is that really what you believe? How can you reconcile that? How can you worship such a deity?

              Maybe someday God will “set a spark” in my mind in the form of valid evidence that he exists. That would be great. However, I still would not be a Christian. I would obviously no longer be an atheist, but I would still argue and fight against any deity who was as immoral as your deity of choice. Any deity that would torture or allow for the torture of human beings for all eternity is simply not worthy of my worship… or anyone else’s worship. Look into your heart Elizabeth. Any deity that allows for the existence of a Hell cannot be worth your devotion. You know this to be true. I have faith in you.

            39. God made Hell for the devil and his angels. Hitler was redeemablebut the question is did he want to be redeemed? If he repented. Good. If not, so sad. God gives everybody the chance to choose heaven. Y wouldn’t they? You are given a chance right now to serve christ yet you refuse knowing that “if” god exi st you will go to hell. Y would u choose that? And how is that gods fault. It was never intended for humans to go there. God gave his only son so we wouldn’t have to go to hell. God wont force u to believe. ..

            40. “You are given a chance right now to serve christ yet you refuse knowing that “if” god exi st you will go to hell. Y would u choose that?”

              Socrates answered this very question when he told Crito, “It is always better to receive an injustice than to do an injustice.”

              Your view is that God created everything and is perfect in every way, right? Therefore, let me explain the situation to you. Imagine if you will, a mugger come up behind your friend and puts a gun to her head demanding that your friend hand over her purse of get shot in the head. What is your friend to do? Let’s say your friend decides not to give up her purse. The mugger then shoots your friend in the head. Why did your friend commit suicide? After all, it wasn’t the mugger’s fault that he shot her in the head. He gave her a choice and she knew the consequences and yet she still did not give up her purse of her own free will. Clearly that’s a suicide, right? Of course not. Clearly we should hold the mugger responsible. God is the same way (except that we actually don’t know the consequences). According you your story, God created a situation where human beings will be tortured for all eternity unless we enslave ourselves to him and accept Jesus as Lord. It isn’t our choice here, it is God’s choice. He allegedly has the power to change this whole situation. He is not a mere powerless bystander. He is the all-powerful creator of this whole situation — according to Christianity’s own story. The great news is that the whole story is all bullshit and none of it is real. But if it were real, I still would stand against your deity because torture is immoral and it is always better to receive an injustice than it is to do an injustice. Socrates was indeed a wise person.

            41. That is the craziest thing I have ever heard. #1. Suicide? No. Would I say afterward she picked her consequence? Absolutely. It would be a very foolish thing to do… #2. God isn’t unjust like the mugger. #3 how would serving God be an injustice? #4. I am not “enslaved” to him. I love him and my life very much. I am more free than any atheist will ever be! :-) #5. I hold a job. Imagine with me for a minute… I decide the way the boss says to do it is stupid and I do it my own way. The boss tells me if I ignore his instruction again I will be fired. I do it my way anyway and he fires me. He knows I have 3 children and its hot outside and now I can’t pay my bills. That boss was so wrong, right? He wasn’t a fair boss. Now I can’t pay my bills and he knew it. That is just mean!

            42. #1 So you think she choose to be killed? Foolish or not, it wasn’t her fault that a mugger shot her in the head, right?

              #2 You say that God isn’t unjust like a mugger. I don’t agree. The character of your God as portrayed in the Bible shows that is is unjust. The fact that Hell exists in that narrative is evidence of that. As I said before, no one deserves to be tortured. Not for five minutes and certainly not for all eternity. That is injustice! It is injustice to punish finite crimes with an infinite sentence. Plus, to call the list of forbidden things in the Bible “crimes” is a stretch already.

              #3 Servatude at the point of eternal torture is the very definition of injustice.

              #4 The Bible makes it clear that we are to serve the Lord as our Master. Women are even considered the property of their fathers and later their husbands. Rape is a crime not against the woman, but against the woman’s owner. The Bible makes it very clear that if a man rapes an unmarried woman, he is to either pay her father for damaging the goods or to buy her through marriage. If a man rapes a married woman, he must be put to death for breaking her husband’s property. It’s in the Bible! The Bible makes it very clear that we are to be slaves to God and that women should be slaves to men.

              #5 Here is the key difference here. You entered into a contract with your boss for the job. You signed on to the plan. You took the job knowing that you have to listen to your boss. I didn’t sign on for the whole Heaven and Hell nonesense. That wasn’t my choice. I can’t get another deal (according to your religion).

              #6 It doesn’t really matter because it is all bullshit anyway. That is the great news. Hell is imaginary too! God doesn’t exist and the Bible is complete fiction. Live you life! Free yourself from the bullshit. You’re not going to Hell, because Hell doesn’t exist.

              Please think about this conversation. Think about how in your religious view Hitler might be experiencing paradise for all eternity while the Jews he threw into ovens are roasting in Hell for all eternity because they didn’t accept Jesus. Is that really your idea of justice? If you believe that morality comes from God, then it must be, right? But maybe, if I am right and morality comes from human empathy, then justice is something else. Then God can be immoral and the concept of Hell can be and should be morally wrong. Just think about it.

            43. By not believing what could be true you are committing injustice… Let’s say ur in court and u didn’t do the crime but ur found guilty cuz no one would believe you.. You have been dealt an injustice.. By believing what could be a lie you receive an injustice and cannot be faulted for your trust.. Do you understand the words you speak.. BTW Socrates and Crito nice name drops..

            44. If you ask and are humble he will meet u more than half way.. Ask for anything but don’t be selfish and be specific so there can be no doubt… He won’t go the full way.. You have to try sincerely Or he won’t even be able to look at you.

            45. “It could have been unicorns” Nice. More snarky condescension instead of respect for your adversary.– “herbal concoction you got from a health food store” Really? Where’d you dredge that up from? Can you grasp why you come off as a moron?

              — “But most likely, your cancer went into remission on its own. We don’t really know why cancer does that (to my knowledge).” You have ZERO knowledge, but a SHIT-TON of BS!! “Most likely”?? What do you base that on?? You got some science behind that ludicrous statement?? “We don’t know”?? We don’t ** know** ANY of the answers to ANY of the religion vs. ‘voo-doo’ debate, but tools like you are adamant that YOUR ** opinion** is the right one!!

              “Opinion is the medium between knowledge and ignorance.” – Plato

              Let me help you out, skippy; As we CANNOT **know** either way, your digging in AND then INSISTING that others are the stupid ones for believing what they choose to believe, AND even INSULTING them with your incessant condescension and/or snippy remarks IS stupid. A very intelligent person does NOT declare that they are an atheist, but, rather, agnostic. When you CANNOT know something, but you DEMAND that your SPECULATIONS are CORRECT, you ARE stupid.

            46. Insults and condescension? You would know “skippy.” lol

              For the record, I never said that all people who believe X are the “stupid ones.” In fact, i have stated and written articles saying the exact opposite of that.

              Also, you should know that I do call myself an agnostic… and an atheist. They are not mutually exclusive terms.

              BTW, should I be capitalizing random words? Does that make comments more intelligent? Please, I would like your expert opinion on that. Thanks! 😉

            47. Capitalize words if u want emphasis… Why not keep your arguments on topic instead of giggling like a schoolgirl with self satisfaction every time u get owned and just deflect or avoid the question… How much do u get paid to do this? That is the only explanation for your closed mindedness and downright insulting demeanor.. I’ve respectfully argued u at every turn and u ignorantly fight back acting like idk what I’m talking about when u imagine there’s a difference between a theory and a scientific theory.. One of them doesn’t exist.. Guess which one… U can’t argue cuz ur wrong and ur intentions are even worse.. And ur clueless.. About everything u claim to be enlightened on.. Yes every scientists expects creationism to be disproven but its not yet and they recognize that.. Say its made up all day.. Its still considered a theory by science until its disproven. U obviously never set foot in a university.

            48. I disagree with what you said about prayer. Prayer brings people hope, and prayer puts faith and energy into people; they are motivated to get better. AND GUESS WHAT, some of them DO get better. It is kind of like the placebo effect in a way..
              My mother suffered from Highmoritis as a child, and the doctor told her that they would have to perform a surgery on her. pills to herbs on my mother..Nothing helped. Then one evening my grandmother went to church and prayed and prayed for my mother..A week later? My mom was cured. When they went to the doctor and took the Xrays, they were astonished..Because all that was left of that Highmoritis was a swelling, nothing else, and no surgery was needed.
              This isn’t the only “prayer miracle” story, I’ve had some things happen to me and prayers saved me. So. Bottom line:Never, ever underestimate the power of a good prayer.

            49. Holy freakin’ wow, dude. You are a wicked ASS. You are so haughty and condescending/ disrespectful!!!! Is there something wrong with being a sheep herder?? Do you “think” they were less intelligent than anyone else? Do you think there were ZERO geniuses 2000 years ago?? What does being 2000 years old have to do with its’ veracity? Not smart, skippy!!

            50. For the record, sheep herders herd sheep. That is what they do.

              Second, my five-year-old son has a more accurate understanding of the universe than the smartest genius from 2000 years ago. That isn’t to say there were no geniuses 2000 years ago; it is to say that human knowledge has grown tremendously since then. Democritus was a genius 2500 years ago and he came up with the hypothesis of the atom, but he had no idea about gravity, electricity, flush toilets, or a host of other things that we today take for granted as obvious. One advantage of humanity is that we pass on our knowledge so that the next generation can learn from it and build off of it. So yeah, I don’t take the “wisdom” of 2000 year old sheep herders as being wise today. Sure, some of them may have had some great wisdom for their day, but we learned shit since then (like that women are not actually the property of their husbands or fathers and that slavery is morally wrong).

            51. I’m with Jesse Ventura on this topic. “Religion is for the WEAK MINDED.” I would add “intellectually lazy” as it far easier to believe what someone tells you than to do the research and find out the TRUTH for yourself.

            52. so your saying you figured out big bang/evolution/others for your self. are you sure no one told you these things in a book. pretty sure christian knowledge comes from a book also, it’s pretty hypocritical to say your knowledge from a book or the net is research, but someone elses knowledge from a book you don’t agree with is intellectual laziness, isn’t it? you can’t prove there is no God, and I can’t prove there is a God. yes athiest think they are better than everybody else, that is why they are constantly calling christians stupid! grow up all!

            53. Oh, so you believe all books are equal. I get it. I guess you think Harry Potter is real too. After all, you can’t prove he isn’t real, right? Talk about hypocritical!

            54. I didn’t say that in the least! who’s making up things now! what I said, was that those books you read are no more absolute than the ones christians read. neither of them have been nor can be proven. stephen hawking even says: we don’t know how all of this came about, but there are several theories! why is it so terrible to let christians have one of those several, if we turn out to be wrong, it won’t hurt anything anymore than when one of the several scientific theories turn out to be incorrect. you and I both know they can’t all be right!
              somehow I don’t think you know what a hypocrite is! nothing I said in the other post was even remotely hypocritical.
              you however are telling others to expand their minds and think about what you are saying, while at the same time you are totally dismissing everything they say. yes, that is a bit hypocritical. and yes, christians are just the same.
              none of what I am saying is to make you look bad! but, your still gonna make out, like I’m an enemy of knowledge. this isn’t the case! I think in the case of atheist vs christian, one could learn from the other without criticizing the beliefs of the other. this however, never happens, because one is always to busy calling the other stupid! both christians and atheist need to grow up. we don’t have to be enemies.

            55. If you read through the comments section, you will see that I have been called stupid and personally attacked and even threatened and yet you will also notice that I have not once called anyone stupid (with one exception because he started it and I wanted to make a point) and have never personally attacked anyone.

              Now, I don’t want you to think that I am calling you stupid here, because I’m not, but I do want to know if you understand the difference between “a theory” and a scientific theory. It has been my experience that many Christians do not and this is a very important difference and I want to be sure that we are both on the same page here.

              When you claimed that all books were equally valid, I think you have missed quite a bit of that difference. If you don’t know the difference between a book written by a cosmologist about cosmology and an ancient story book series written by anonymous authors who obviously didn’t have the scientific knowledge we have today, then you have some learning to do. Not because you aren’t a smart person or anything like that. You very well might be. But because you are ignorant of some very important facts. That’s not a problem though, because you live in the information age and you can learn this stuff. Google is your friend. Find out why Stephen Hawkings book is valued and respected. Check out Lawrence Krauss’s book, “The Universe From Nothing” and learn why we know what we claim to know about the cosmos. More importantly, you will learn what we don’t know, but why we suspect based on the evidence we currently have. This is different from just making up answers to questions we don’t currently have answers for.

            56. Im not arguing against science, and I don’t think science its self is an argument against God. what I am saying is this; in the 1800’s the ice age was a huge debate among scientist. we now know the ice age was a factual event. and still, some christians, and some seculars refuse to believe it ever happened, but the bible backs up the theory in Job 37:10.
              some have problems with the big bang on both sides, but again the bible backs it up in Issiah 42:5
              on the flipside many atheist say that we christians believe that the earth is flat but Issiah 40:22 tells us that it is not. many say we believe in unicorns, but the word unicorn used in the bible is hebrew for wild bull.

              I agree with you on many of your arguments. just not the one that says there is no God. it is true that many so called Christians judge you and all athiest, but you can believe that if Im right, there won’t be much of an eternity for them, as their bible tells them:

              “judge not and you will not be judged, condemn not and you will not be condemned”

              it is the same on both sides of the fence, and there needs to be an end to it for sure. but, I don’t think I have enough faith, nor do you have enough science to put out that fire. so I guess me and you both will just have to deal with it.

              oh and please don’t think I dislike you just because we don’t totally agree on the way it all got started. I may be christian, but, I have athiest friends. they try to convert me, and I try to convert them. it’s good fun.

            57. There are also some scientists who claim that the sun goes around the Earth… and Joshua 10:12-13 backs that up. Oh wait, there are no scientists who accept that.

              There are some scientists who claim that the Earth is flat and Isaiah 11:12 and Revelation 7:1 (among other verses) backs that up. Oh wait, again no modern scientist accepts that. I can go on all day with this. The Bible is not a science book and there are about a million examples of scientific claims that the Bible got absolutely wrong.

              I also want to point out that you are using scientists as an authority when the real authority is the evidence. There are going to be people (even scientists) who believe somethings on poor reasoning but the real issue is whether or not the evidence supports the claims.

            58. I just want to point out that I was trying to be civil, and have a conversation.
              first of all I don’t care what scientist said what! I was using the evidence which was provided by scientist, and evidence found in the bible that concurs with science, to show other christians that it is not compromising their faith, in saying that the big bang could very well have happened.
              second the four corners, and the four winds refers to north, east, south, and west. you’ve heard that expression all your life and you know this is true. your grasping at straws.
              and God forbid someone who was alive 5000 years ago ask God to make the day a bit longer. this sun stand still was what joshua asked God, was it a mistake on Joshua’s part? yes, But pluto was a planet until a few years ago. I wonder if the bible caused that one. nope!!! your science book called it a planet too. hmmm!
              well like I said, I was trying to have a civil conversation with you. but your only interested in arguing, so have fun with that.

            59. I’m being civil too and my point is that your examples are also grasping at straws. The Bible does not back up any scientific claims at all. When you claim that it backs up the Big Bang or the Ice Age, you are grasping at straws and someone could just as easily point out wrong scientific theories that the Bible “backs up.” The Bible is not a science book; it is a book of myths. It was not written or divinely inspired by an infallible deity; it was written by bronze-aged sheep herders.

            60. That the Bible (and the Quran) are not science books is absolute fact. That they are books of myths is somewhat inaccurate — rather the best that an intellectually honest atheist can argue is that they begin with myth and end up as a historical fantasy [meaning it has both historical fact and fantasy mixed in with it, not unlike the Illiad of Homor, which absolutely was based on a historical reality — otherwise Troy could never have been found by Schliemann]. That they are not written or divinely inspired by an infallible deity is pure opinion since there is nothing in them that are falsifiable because you fail to understand that their purpose was NOT to describe reality but rather to illustrate lessons for life using literary techniques that the common folk could understand. Thus, it matters not whether the flood was a localized event (a virtual certainty) or a woldwide flood (impossible). It was to illustrate the need for man that all of life is not for his exclusive exploitation. Similarly, the Tower of Babel need not be a real skyscraper but rather a mechanism to explain that man needs to be proud but not arrogant with what he can accomplish.

              That the Bible was written by bronze-aged sheep herders or the Quran was written by an illiterate merchant is laughable since both books certainly make great literature that have stood the test of time like few other works of similar ancient origin (and NONE of those other works [the Illiad, the Odyssey, the Trial of Socrates, the Republic of Plato, the Tao Te Ching, etc.] have been read by as many as have read the Bible and the Quran, so the Bible and Quran are BY FAR the most influential writings ever known to man).

              No, even if they are not divinely inspired (your opinion, not mine), they are certainly creatively inspired by an awe-inspiring muse in such a way that one should not denigrate either text.

            61. I agree with you on most of that. However, you failed to consider how they become so popular. Here is a hint, MASS MURDER!

              I don’t think there is much history presented in the Bible. I can’t speak for the Koran, but almost none of the Bible is based on any real historical events.

              And while many people have found a great deal of positive meaning in these texts, there are now out of date and causing far too much negative meaning in people’s lives. While the Illiad was much better written than the Bible, if people today took it literally true, I would be pointing out why it is a ridiculous story to be taken seriously. I would be pointing out all the inconsistencies with our current knowledge and any self-contradictions it might have.

            62. The bible is very historically accurate. Follow the history of Israel, study the life of Jesus, the old testament kings, the empires of Babylon, Persia, and Rome. Study the greatest, most life-changing book ever written.

            63. Your comment that there is not much history presented in the Bible betrays your lack of knowledge concerning it. The first few books contain almost nothing BUT history of the world and the human race, and much of the rest of it is history as well. The fact that you don’t recognize the real historical events in it doesn’t mean it isn’t based on them; it merely means you don’t understand what it’s talking about, or the names of the countries at that time. As far as it being out of date, it’s much less out of date as tomorrow’s news, since much of it deals with prophecy which has yet to be fulfilled, more of which is in the process of being fulfilled daily. In fact, considering how much of what has been prophesied has already happened, there’s not a lot left to be fulfilled before Christ’s second coming. Perhaps you need to read it over again with a more open mind (if you’ve read it at all), instead of believing what other atheists are saying about it. You’ll likely find that there is much that you’ve missed.

            64. I find it iron that you’re criticizing these nut-job ads, but you have the EXACT same crap on YOUR web page (Around the World). Hypocrit much, bro?

            65. Many more professions wrote than just “sheep herders.” Let’s see, cattle rancher, pig farmer, former prince of Egypt, tax collector, fishermen, a lawyer, a physician (mostly likely a holistic healer, an herbalist etc.) among many other professions, and they lived in more times than just the “bronze age.”

            66. 1. it’s a figure of speech. 2. no one knows who wrote the books of the Bible. They were all written anonymously and many were passed on through oral tradition long before being written down in the first place. And I haven’t even gotten into all the editing and translating that came about afterward.

            67. It depends on what you’re calling “science.” Are you aware that there are many Christians who are also scientists? It’s not either/or. A person can be both a Christian and a scientist, and not all scientists agree. It’s just that secular scientists claim to have “proven” certain of their pet theories, which existed before any of these scientists existed. If evolution is a fact rather than a mere theory, tell us why, if we sprang from monkeys or fish, there are still monkeys and fish, but we don’t see any in-between stages. I don’t think you or anyone else can adequately explain that, unless you go about eliminating those species on your own to try proving your point.

              Try reading the Bible without any preconceived notions, giving it the same chance you give the other books you read, but bearing in mind that while the Bible was written by men, they were men of God, inspired by the Holy Spirit. That’s the difference between the Bible and other books, and despite all of man’s efforts throughout the ages to eradicate the Bible, it’s never happened. No other book imparts life, and any other book would have disappeared long ago had men expended so much effort to eradicate them. There’s a reason for that. There’s also a reason that the Bible, with it’s 66 books written by various men at different points in time, basically does not contradict itself if read under the guidance of the same Holy Spirit who inspired it. Read in that way, it’s extremely accurate, which would not be true of any other book written by so many different men over such an expanse of history. That explains why the experience and knowledge of those of faith is so different from those without faith. You cannot read a spiritual book with the same approach used to read a history, science, or literature book, and get God’s intended message from it, although the Bible contains all of those elements, as well as being the owner’s manual God gave us to instruct us on how to live the life He also gave us.

            68. Sorry Dangerous Talk, you do not understand the verses you have alluded to. Joshua told the sun to “stand still,” which is a figure of speech, and the literal event is that the earth stood still. Hmmm, could it have possibly just not revolved? “Four corners,” from Isaiah 11:12 and Revelation 7:1 is also a figure of speech, but there are four directions east, west, north and south are there not? God does not see the same way as we see, like here, it is day where someplace else it is night. In a sense, from his perspective, it is all like a flat sheet, nothing is hidden.The Bible told people a long time before the dark times of: ‘don’t go too far or you’ll fall off the earth,’ that it was spherical, that there are different times zones and many other scientific matters that science and technology would one day catch up with, to understand. A figure of speech by the way is, a legitimate grammatical usage of words that may be thought of as, truer to truth than a literal statement of fact. For example, the ground is dry or the ground is thirsty. Figures of speech is what God used to mark His word as to what He says is important or wants emphasized. The Greeks catalogued some 200 of these scientific (no guess work, but mathematically precise and scientifically accurate) figures of speech. Of these, some 120-125 are used in the Bible with sometimes there being 40 variations under one figure. A phD in English probably has never been taught more than 40 figures of speech. Figures of speech could be a lifetime career alone, if one wanted to research these, become better readers or writers. But the point is, IF God, the creator of the universe, the galaxies, our galaxy and including the moon, sun and stars for “signs and seasons,” and our earth with gravity and rotation etc., wanted a day to not end for a time, he could and did. Computers with specific programs, years ago stopped running sometime in the distant past, and science could not understand how a day could possibly just “stand still,” but it did. And it wasn’t too long ago that ice was found floating around in space, which the book of Job alluded to 1,000’s of years before we had the technology to see these masses of ice, remnants of the water which abated off the earth that nearly every civilization recorded and science has attributed to the earth being flooded with water. Truth never contradicts true science and true science never contradicts the truth. It is our lack of understanding which is, the contradicting factor.

            69. Wow! The funny thing is that you are probably being sincere in your desire to excuse this stuff. The problem is that you are so eager to excuse the problems in the Bible, that you latch on to the most ridiculous of excuses. Figure of speech? Yeah, these are figures of speech… NOW. But that is because at one point people actually believed them to be literally true (as recorded in the Bible and elsewhere). Now we know better and so they are just used as figures of speech because we don’t want to give up saying them. But your insinuation that the Bible is 100% accurate really is laughable. There really is no doubt that ancient Hebrews from that time and place really did believe that the Sun revolved around the Earth and that the Bible is indeed a record of that belief. I hate to break this to you, but people wrote the Bible. Those people did not have our current scientific understanding and as a result the Bible simply isn’t accurate and it certainly isn’t inerrant.

            70. No excuses. I don’t have a problem with people believing a lot of different things according to their understanding. That they wrote was their business. What they wrote is what God wanted written. The figure of speech was just that WHEN it was written, not just “NOW.” From their point of view, the sun appeared to just stop moving that’s the figure. The literal was, the earth stopped moving around the sun. .

            71. I’m sorry, but your view of history is inaccurate. The people who wrote the Bible really did believe that the Earth was the center of the universe and that the sun revolved around the Earth. The facts are the facts. Feel free to look it up in any reputable source.

            72. “They” did not say, he, Joshua said it and to them or “they,” the sun did not seem to move or the moon for about a day. But the language of the words IS a figure of speech. What is emphasized in the figure is not what it appeared like, but that it was done and by whom it was done. Joshua spoke and God honored. “Sun, stand thou still upon Gibeon; and thou, Moon, in the valley of Ajalon,” attributing human characteristics (standing – not moving) to the sun and moon and addressing them as individuals “thou” [you]. Had he said the sun will not move or the moon, it would be inaccurate because, the sun does not move, only the moon and the earth. Even though he may or may not thought both move around the earth, the figure does not contradict the literal event. Joshua could have just said, the light of the sun and moon will not cease until we have prevailed upon our enemies. Come on, we still use the same type of figure in the words “sunrise” and “sunset,” even though these are not literal, but it gives language more interest and it still appears as if, this is what is happening.

              .

            73. You admit that the people who wrote the Bible believed that the Earth revolved around the sun and yet here you are trying to make excuses for why they wrote that in there book. Do you understand why that might seem a bit silly?

              Why not just accept that they meant what they said since we know from the historical record that they actually meant what they said?

            74. I don’t either have a problem with their perspective at that time nor think it this is silly at all! Do you not understand that it is silly to try and make what is clearly a figure of speech, a literal statement of fact? Do you normally have a conversation with sun or the moon? Have you never seen what appears to be railroad tracks converging in a distance? What it looks like is not what it actually is, is it? The language, the way in which the words are written are figurative. What happened actually was literal.

            75. Maybe we are talking past each other here; I don’t know. But the people in that time and place literally believed that the sun revolved around the Earth. In the Bible, they wrote as if the sun revolved around the Earth… not in a figurative sense, but because they believed that literally. We both admit that they believed it literally. So I’m not really understanding what you are saying here.

              Example: I believe that the Earth revolves around the sun so I say something like, “The Earth stood still.” The implication being that the Earth literally stood still. That isn’t a figure of speech if I believe that it is a literal fact. It could be a figure of speech if I was referring to a sense of time standing still, but if the context indicated that I believed this literally (which the Bible’s context suggests about the sun), then it isn’t a figure of speech.

              My point is that while today we understand certain facts about the world, back then they lacked our modern understanding. They literally believed that the sun revolved around the Earth and their writing supports their literal belief. It wasn’t a figure of speech. They really believed it to be the case… literally.

              Maybe we aren’t using these terms the same way. But the way I understand it a figure of speech is not meant to be taken in a literal manner. When I say “time stood still” for example, I don’t mean that literally. It is a figure of speech because I am aware that time does not actually stand still. But if I were someone who believed that time could stand still, then such a statement wouldn’t be a figure of speech any more as I would probably mean it literally.

            76. Again, your lack of understanding is betrayed. The people who wrote the Bible under the inspiration of God’s Holy Spirit had understanding that you and other atheists lack. As far as your “scientific understanding” is concerned, time will reveal that much of that is errant. I say “your” scientific understanding because scientists who are also Christians have an understanding of science that non-Christian scientists do not have, which widens and broadens the opportunity for non-Christian scientists’ findings or results to be errant.

            77. Actually I had the benefit of talking with a professor of mine who noticed that no one ever tried to determine how much pull the sun has on the earth.. So using the moon and earth as a starting point he formed an equation that pretty shows that it might be really weak… That doesn’t seem too far off considering its made of the lightest elements in the universe and being hot is probably not very dense.. Even though he sun may look larger it may have less mass… Understand that mass is not weight or volume.. Basically the earth is denser so by his math the sun could actually go around the earth.. But that’s not even a theory but anyone could see it for themselves..

            78. First, that isn’t a theory; it is someone’s crazy belief.
              Second, we know that the Sun does have a pull that extends past the Pluto.
              There is so much evidence supporting the theory of gravity and the theory that the Sun is the center of the solar system that your professor would have a hard time convincing anyone of his belief without some really, really, compelling evidence.

            79. Our beginning by evolution and the Big Bang are also theories taught today as fact, but they’re also many people’s crazy beliefs that have no basis in fact. A person can make people believe almost anything if they tweak the findings enough and then finagle their explanations. Such are many “scientific” findings concerning our beginnings. Since you were there at the time, tell us who or what evolved or banged if this all came about without intelligent design.

            80. I had advanced stage cancer.
              I did chemo, became pregnant and missed my “window of opportunity” to benefit from radiation.

              The biggest thing about chemo is that it FORCES YOU TO FAST.
              Your cells stop dividing, your metabolism slows, and no amount of steroid can make you eat.

              I would recommend fasting, but chemo is a huge help if you don’t have the discipline to starve. 40 days is a little much

            81. Stephen hawking admitted that most of his theories of black holes were wrong… I don’t think Stephen hawking is nearly as respected as he used to be.

            82. Stepehen Hawking admitted that many of his ideas about black holes were wrong and that is not a bad thing. Based on new information, he revised his ideas. That’s what science does!!!

            83. He changed them because people were afraid based on his theories that if the hadron collider did open a black hole we would all be swallowed up so he was like nah I was wrong let’s do it… It wasn’t new evidence… Except the naked singularity where light can escape is the main thing that he was proven wrong on it is possible And did u delete my other comments?

            84. 1. I have very clear rules on commenting. I don’t recall deleting any comments recently, but if your comment broke one of those very clear restrictions than I may have.

              2. I doubt very much Hawking changed his opinion on black holes because he feared being wrong. As a scientist, Hawking wants to be proven wrong. That is how we learned things.

              3. Are you claiming that light can escape from a black hole? If this is your belief, you are almost certainly wrong.

            85. I have read over the thread and I find it distasteful that Christians attack anyone for their beliefs. I believe the Bible advises against this. I know Jesus did. Anyway, I am very analytic in my dealings with information and think in synthesis. But it occurred to me that I cannot close my eyes and imagine oblivion (complete nothingness) since it is nonsequitur. Therefore I must believe in infinity. Now just because we are on a specific slice of existence with entropy basically shaping our path does not mean that there are infinite slices of existence and in fact there must be in order to fulfill my belief. Moreover, there must be a force for creation, we labeled it God) and then there must be a force governing our plane of existence (entropy=chaos=disorder/time) and we labeled this force Lucifer/Satan, etc. But there are infinite realms in that our mathematics cannot explain due to us not being able to perceive or observe. This is obvious when you really get into the quantum level juxtaposed to classic mechanics. Everything gets weird and really everything we see is not right either. So, my friends, thought is real, emotion, feeling are too no matter what else is not. Our spark of life is not from within…how can it be? The computer has a body, hard-drive, and even software just like our bodies right? Right? But it does not work…why? It needs electromotive force from the outside via the electron (we do not even understand this stable charge). Similar to the electron we too need an electromotive force via our pineal gland spiritual energy which is derived from outside this plane. We get recharged via REM at night. Our window has become very small now though as we travel down the road with entropy increasing. Soon with the wars and hate (as seen on this blog) entropy will be max and then come equilibrium to right itself and the system(s) begin again. Everything in this system is just a vibration just as you are just a vibration (energy) but when you die your encapsulated vibration which makes up our entire lifetime programming goes on. You must, you see, yours is to perceive existence and give reality meaning. All life does. But you will go onto the next plane to perceive again. Until one iteration you can remember and have taken in enough energy through your meditation (actual prayer) that your mind is fully opened and your become a higher level being ready for the next plane of existence. This goes on forever. When you die…go into the night with love, forgiveness, peace, and knowing you will go on and do your best (faith). This is aligned with the creative force. Go with hate and bitterness or fear and you are aligned with Entropy and the lower level forces. That is all there is to it. You will judge yourself because the truth is evident once outside your body. God is not required to sit on high and judge you…Hell is here now (Hell mean the pit or hole). Old English word for the grave.

            86. Yeah obviously ‘people’ wrote the kjv bible but no man can write the truth. did it not ever cross your mind that god told each person excatly what to write! and asfor that “oh so you believe all books are equal” Uh no. When i opened the kjv bible for the first time i didnt just say “oh this book says god is real so that must mean he is real” foolish. i believe god is real cause i based it on the facts around.. and in the world and the people in it.
              Atheist Man: Show me than i’ll trust you.
              God: Trust me.. and i’ll show you.

            87. Anyways guys everyone has a free will to believe or not to believe we all have options and opinions. And if god is not real and we all find out than so be it… but i’ll take that risk. actually its not even a risk because i have had a dream like no other ever! nothing i have ever imagined or even thought of. has the atheist read the book of bible codes… though if that havent accepted the kjv bible the truth they wont accept anything till its too late:( bow down before its too late.

            88. “Yeah obviously ‘people’ wrote the kjv bible but no man can write the truth.”

              The door is closed. There, I wrote the truth. I guess you have just been dis-proven.

              “did it not ever cross your mind that god told each person excatly what to write!”

              It crossed my mind but if that was the case, why did he tell different people contradictory stories about the same events? Why does God have such a poor grasp of science and history? Why is God such a woman-hating assclown?

              “believe god is real cause i based it on the facts around”

              Awesome, then present some valid evidence for these “facts” and let’s test them scientifically so that everyone can be reasonably certain God is real.

              “Atheist Man: Show me than i’ll trust you.God: Trust me.. and i’ll show you.”

              Been there; done that.

            89. Are people all the same, and do they see things from the same vantage point? No. Some people see things appearing a certain way, and others see it differently. That’s obvious when people give testimony on a particular event in court.

              Does that mean they were contradictory, or that one was telling a lie? Not necessarily. It only means the vantage point was different in the telling of the same story. Overall, the stories about the events in the Bible are valid, and they’re not contradictory in their basic elements. It only seems so to one who doesn’t have the guidance of the Holy Spirit in reading it.

              As I’ve said, if you need proof of everything that exists, stop breathing, because you can’t see air. The truth is, you don’t have any more proof for things than anyone else; you just think of yourself more highly than you ought, have preconceived notions, and like to argue. That’s the bottom line.

              No, you’ve never been there and done that. You’ve never come before God with a humble spirit, nor trusted Him, because you don’t have a humble spirit and therefore, find it impossible to trust anything you can’t see or haven’t been convinced of by someone else who thinks exactly like you do. You’re arrogant and haughty, and think yourself greater than the God who created you. So did Lucifer, and if you’ve read the Bible, you know what happened, and will happen, to him.

            90. Now, Dangerous Talk, THIS comment of yours is nothing but totally hypocritical!! You seem to feel that you reserve the right and reason to say anything you choose about others and their views on your site and in your books, but they dare not saying anything back in rebuttal. Please remember that you were the one who started this whole conversation. Any “attacks” and “threats” are merely in response to your arrogant remarks about others. Don’t do the disservice to yourself of trying to appear innocent in this whole scenario. I think you’re finding that those you label so “unknowlegeable” are much less so than you thought, but we all know you’ll never acknowledge it as long as you’re an arrogant atheist. (And yes, you are.) That’s a fact, not faith.

            91. No, they’re not equal. The Bible has infinitely more authority than all the books in which you and your friends put so much “faith” and trust.

            92. Not one person can be verified historically! I know you atheist like facts hehehe Why do all atheist always choose Harry Potter Books and make the same stupid remark. Is that in the atheist handbook or something? You must live in the UK hehehe You atheist always cling to your God (Science) which is WRONG every day! You claim to be objective and scientific then spew narrow-minded dribble. When will you learn that Christians dont really care what you think! I just miraculously stumbled across your ridiculous article and just had to drop a word or two. Get off your high horse and get a life!

              It is clear that you don’t believe in God and I am sure he does not believe in you!

              https://www.youtube.com/watch?v=gslOnN3zWmA

            93. I’m still waiting for you to prove Harry Potter is not real. For the record, you chose that example. I usually pick Darth Vader.

              Science is wrong every day? Really? How is it you are on the internet that science built. Next time, just pray to God to deliver me your comment and we’ll see how well that works out.

            94. I already answered you! Even Darth Vader and all the characters can not be verified as ever existing historically – that simple!

              Are you saying that people noted in the bible can not be verified historically? Ignorance is bliss huh! or blind denial!

              Yes, science is wrong every day – Does your ignorance in science think that science is always right? Science just announced that The so called BIG BANG theory is bullshit! Quantum Equation Suggests The Big Bang Never Occurred – The Universe Has No Beginning. The backbone for the Science joke called, “EVOLUTION”.

              I would not call the internet a full aspect of science like gravity, space,energy, mankind, archaeology, ect. but rather a small application of scientific knowledge for practical purposes that has been enhanced by inspiration. Everything is a form of technology to better man. As man’s thought expands and so does ideas and science. However, I believe God inspires man!

              I pray to God all the time. (daily) He has answered my prayer all the time. The power of prayer and God is amazing!!! You must understand that if you are not right with God living a clean life following the word of God,your prayer to God will just fall to the floor. Thus, your comment of just to pray to God to deliver me your comment and we’ll see how well that works out is just monumentally ignorant and just makes you look stupid. Especially not even knowing how prayer works and the power of prayer. No religious person would pray to God to answer his comments for him but a prayer to God for inspiration to answer your comment is a valid prayer.

              Question: Have you read the bible completely?

            95. Wow, first you relied on science deliver your comment when you were told to pray that God would deliver it. So I guess your faith in God is lacking. Second, you still have not disproved Harry Potter’s existence. Saying that you can’t verify any historical figure doesn’t disprove Harry Potter. Third, science adapts. Far from disproving the big bang, we now have even more evidence in support of the big bang. We have seen what the universe looks like less than a second after the big bang.

              Here is a little experiment. Pray to God that a million dollar miraculous appears on your kitchen table. Let me know how that works out for you.

            96. You said: Wow, first you relied on science deliver your comment when you were told to pray that God would deliver it. So I guess your faith in God is lacking.

              Answer: Actually, I did rely on God to answer your comment by using the free agency that he gave me by using science that he gave us all for our usage.

              You said: Second, you still have not disproved Harry Potter’s existence. Saying that you can’t verify any historical figure doesn’t disprove Harry Potter.

              Answer: Actually I did disprove it. There is zero historical evidence that Harry Potter existed which disproves his existence is only a story. I bet you wish you had a Harry Potter wand to send me away hehehe

              You said: Third, science adapts. Far from disproving the big bang, we now have even more evidence in support of the big bang. We have seen what the universe looks like less than a second after the big bang.

              Answer: Your statement is 100% wrong! Scientist made a mistake. I suggest you look to main stream science. Check out Quantum Equations and other laws that debunk this theory. The Big Bang is nothing more than a theory that cant be proven. There is more evidence to prove otherwise. Just the mere fact that this theory breaks down the law of Physics has many scientist moving away from the old Big Bang theory. I suggest you study up!

              You said: Here is a little experiment. Pray to God that a million dollar miraculous appears on your kitchen table. Let me know how that works out for you.

              Answer: Actually I did and I received 3 Million.

              I like how you spew questions but dont answer mine. I will make it simple for you. One question:

              Have you read the bible in its entirety?

              Also, for research and for fun – go watch “God is not dead” here is a trailer link: https://www.youtube.com/watch?v=90PWFEeRApA

            97. LOL, your “answers” are comical.

              1. God is supposed to be all powerful and everywhere. So if God were real, you should be able to pray him a message and he should be able to deliver that message to me without the need for science and technology. But if God were not real, then you would need a computer to relay your comment to me.

              2. J.K. Rawling has documented Harry Potter’s existence. Also, there is more historical documentation for Harry Potter than there is for Jesus and way more than there is for God.

              3. Quantum Theory has absolutely nothing to do with the Big Bang and in no way “disproves it.” Like I said, we have actually seen the universe less than a second after the Big Bang.

              4. Really? You prayed for a million dollars to miraculously appear on your kitchen table and three million miraculously appeared right before your eyes? I find that impossible to believe.

              5. Yes,

              6. My review of God’s Not Dead. – http://www.examiner.com/review/review-god-s-not-dead

            98. Your a funny guy! I feel sad for you.

              1. God has used many methods to communicate to man/people. My computer is just another method. This is actually a ridiculous argument for you to pursue.

              2. 100% wrong again. There is extremely more historical evidence of Jesus and God than harry potter or Darth vader for that matter. This is another stupid avenue for you to pursue.

              3. Wrong again. Quantum therory has many aspects to due with Big Bang Theory which again is not proven. It is just a guess! The big bang theory can boast of no quantitative predictions that have subsequently been validated by observation. There basically fudging it to meet there guess.

              4. Believe it or not – that is your choice! But I am enjoying it!

              5. well, if you read the bible than atleast your opposition is valid. I hate it when atheist bash the bible only to find out they have not even read it. They cry out as being analytic, experimental and objective and have not even read the bible. When I come across this I simply tell them to read the bible then pray to God if it is true and they will find the answer.

              6. Your review is a typical atheist bash but I am glad you enjoyed it as much as I did. Your synopsis on the actors abilities is fair. I disagree that religion as you put it prays on the weak. I am far from weak! I read the bible, I prayed and he answered me. I have prayed for many things in my life and they have been answered. You can joke all you like but I have felt and seen not to mention experienced the power of prayer. There is a God and he is definitely not dead and when I die I will be with him forever. How I progress after that, I can only wait and see. It is much better than a dirt nap that you expect.

              In Closing, this is obviously a waste of time so I will just say – You serve God your way and I will serve him his way! Amen

            99. I don’t think you are a waste of time Glade even though you are trying to be closed minded about this. I am always open to new arguments and new evidence. I hope you are open to that as well and if there is anything in me that could be considered faith it would be faith in people like you to discover the truth for yourself. That is why I am here.

              1. You are claiming that God needs computers to communicate? Why can’t God deliver your comments to me without the use of a computer? If he truly is all powerful and all-knowing, he would know the message you would want to send me and he would deliver that message to me in a way that only God can. The fact that God needs to use a computer or even chooses to instead of doing it in a way that only God can, should tell you something about your God… that he is imaginary.

              2. Again, aside from the Gospels, there is no valid contemporary historical evidence that he ever existed. Aside from the Harry Potter books, there is no evidence that Harry Potter existed. There is certainly no evidence for any deity. Now, I can argue that Harry Potter cloaked his existence from the muggle world through magic. I could also argue that there is no way for you to prove that Darth Vader didn’t exist in a long time ago in a galaxy far far away. You just can’t know that. So I don’t think you can prove that either Harry Potter or Darth Vader never existed.

              3. Again, the Big Bang happened. We saw less than a second after it happened. I think you are confused by the scientific term “theory.” This is a common misconception that many religious believers make. I encourage you to learn the difference between a scientific theory and a lay person’s use of the word.

              4. So you mean to tell me that you prayed for a million dollar and poof three million dollars just magically appeared on your kitchen table? How did you explain that to the IRS? Just curious.

              5. Yes I read the Bible. It is an incredibly boring book, but I managed to read it cover-to-cover several times. I even read Genesis in it’s original Hebrew.

              6. Religion does prey on the weak, but that doesn’t mean that it only preys on the weak. It also preys on the strong when they are weak. No one can be strong 24/7/365. I would love to go into more detail with you on this if you are interested. when did you become convinced that God was real, the Bible was true, and that God fucked a virgin just to use the baby for some bizarre blood sacrifice ritual? Just curious.

              BTW, I won’t have a dirt nap, I’ll be dead. When you die, you are dead. It’s not a nap; you really don’t wake up. Life is not a video game and we don’t have extra guys.

            100. I tried commenting on our first chat and 4 times it has been removed so I cant answer you there. I will here since your being semi-nice.

              I in no way consider myself close-minded. Matter of fact, I love discussing this stuff. I see both sides of the debate and basically I cant really prove God exist and you cant prove he does not – just like you cant prove the big Bang, Evolution, ect. . I will answer to the best of my ability your questions.

              1. God does not need computers to communicate – Man does. God would communicate to you personally. To understand this communication process, you would have to read the bible and REALLY understand its meaning. Reading it with a close mind and with objector you will really get nowhere as you have pointed out it was boring. You did not really have the will and inspiration to read it. It would be like me reading a book on Evolution and since I already think it is crap, I would not digest its true meaning. However, I believe we evolve as we become smarter able to adapt better to our environment, But that we came from apes – from sludge is a stretch! To me, that is harder to grasp than God. There is always a missing link in every theory that no matter how many smart statements you post it just cant be proven.

              2. Again, I think you need to study bible history. There is an extensive VAST historical evidence. I cant believe you would even deny this. It goes on and on! Now, Nobody has see God. There are some that have had verbal but not Face To Face. This is clear in the bible. However, God is heavily documented and we can evaluate his existence through Jesus Christ and Old Testament Prophet witness Accounts. However, – yes, none of them have seen him – only heard from him. Can we scientifically prove this – NO! Only by reading the bible and following his way will the holy spirit empower you to hear that still small voice that helps and guides you. You, being a atheist and advocate of science can not even comprehend this until you do the experiment – try! It is easy to sit back and judge others while making jokes and objections. You will never know for sure until you try. That is my point.

              3. All I can say is “Something Happened” we can only see 100 years – 336,000 years before the Big Bang. Again, we dont know for sure and new things are discovered every day. We have no idea why or what was before. Science can only speculate. The bible clearly states similar ideas but we dont know for sure. God created the heavens and the earth. He made it happen! How he made it happen is unfathomably. Science can only guess but it is unfathomably how the universe was created to learned man. Both require faith! Imagine, what was there before? Just vast open space? Where did the matter come from? How did atoms even come to be, electrons , ect. Man can speculate but they dont know. It is unfathomable to imagine God with no beginning and no end. The immense technology or powers that he has. He has conquered death and time. He is endless! You either believe one way or another. I, and many Christians are not against science. I embrace science but that does not change my mind about God or Jesus. Science is nothing more than a tool to expand our horizons. Now, you stated my confusion about theory. I think you are confused. See, a theory In science, is a well-substantiated explanation of some aspect of the natural world through test and observation. However, it is NOT FACT. See,

              Fact: In science, an observation that has been repeatedly confirmed and for all practical purposes is accepted as “true.” Truth in science, however, is never final and what is accepted as a fact today may be modified or even discarded tomorrow.
              4. I prayed for God to make me prosper so that I could help others in need and my family. It was weird, an old law case I filed 8 years ago out of the blue, AFTER I PRAYED, just suddenly settled with ALL taxes paid to IRS in my hand. Believe it or not!

              5. I already discussed how the bible is read above.
              6. Religion does not prey! It is freely given and accepted. The weak, you must mean the poor. The bible, and God gives hope to those who have none. Hope, brings a blanket of security to ones soul. Jesus is the bridge to God. Through him, we can pray to heavenly father and if our heart is in tune with him – He will answer prayer. You can be a skeptic and that is your scientific right but as you have put it – I experimented and it worked. I hear heavenly father through the holy spirits inspiration. You must understand the bible to comprehend this but I can testify that it is real. I was introduced to God in my teens. I read the bible, prayed to God if it was true and a small voice in me said it is. I cant explain the small voice but it was not my mind talking to me in my head. This is what atheist cant comprehend! My life was like a roller coaster but it has leveled out and at age 50 and I am rolling into the station. I look forward to the day that I will be with him and all my love ones that are with him. God. As for Mary, she became pregnant through the power of the Holy Spirit. How this happened is impossible to understand by man. In any case, it happened. To say otherwise is just an opinion. I dont began to even comprehend the powers of God, Jesus and the Holy Spirit. This can not be proven or disproved – before you say prove it. For someone who has read the bible you have a warped and imaginative interpretation of God, Mary and Jesus death and why. Blood sacrifice ritual was humorous. Jesus dies for a purpose. Read the bible again! While reading, try and discover Gods plan why this happened. Dont ask me to explain – read and discover yourself – Why! Be scientific not googleific.

              Dirt nap is an expression that means you are dead. Nap indicates that you will wake up. However, this mean the same as – you will be pushing up daisy’s- meaning you are not actually alive underground pushing up daisy’s from bellow. It means that you are dead and you will be fertilizing the ground and daisy’s will grow. Either way – you are dead. Your concept of death and my concept are 2 different beliefs. You think you will be dead, lights out – done! I believe my BODY will be dead so no due over like a video game BUT my soul/spirit will be called to God. I guess you will find out when you die. I like my choice better! You are your own God! God, The I AM the One true God is my God and he promises me eternal life in his presence which can only be accomplished through the sacrifice of Jesus Christ.

              Hope this helps,

            101. Learning science can be difficult. Learning “God did it” takes no effort or evidence whatsoever.

            102. We, as of now, do not know how Deoxyribonucleic Acid came into existence, however I am inclined to believe the Theory of Abiogenesis due to some supporting evidence. However the creation theory that you believe in has zero supporting evidence, so in the case of no alternative hypotheses I will take the null hypothesis.

            103. Catching up to God’s advice???? really??? Like when God ordered Moses to rape and slaughter all the people in Numbers 31:17-18. How about when the Bible says that women came from the rib of a man? Is there a scientific study that catches up with that? Or when Jesus saw “all four corners” of the Earth? Or when God caused the Sun to stand still? Or when the Bible says that Heaven is a physical place in space that can be reached by building a really high tower??? I guess science is really behind when it comes to SCIENCE!!!! The Bible sure does know better. LOL!!!

            104. Atheist or not I think you may have all missed the point. Faith in Almighty God isn’t about proving his existance and it’s not my job or anyone elses to do that on His behalf. He is more than capable if he felt the need to prove his own existence. If He wants to make himself known to you you don’t need faith in him for him to make himself known to you. This arguement is a pointless one because you can’t argue anyone into heaven or out of it for that matter. You either believe in a god or not and what you believe will manifest itself in your actions. That’s where the true evidence of whether there is a God or not can be found, in our humanity, in how we love each other.

            105. Thay is one of the biggest stories that aren’t actually in the bible. They weren’t going to reach heaven. God told everyone to spread over the earth and multiply. One said wait if we do that well be scattered across the face of the earth like dust. We will stay here and build a tower and show him that we are greater than him.. So when god saw this he thought now whatever they want to do they will do.. And he knew it would not be what he told them so he scattered humans everywhere.. Look that up too linguists are coming to the conclusion that we did not evolve language.. If we did it would be useful not separating like it is.. Chimps the world over speak the same language why don’t we?

            106. 1. I actually wrote studied up on the Tower of Babel a bit and here is what I found: http://www.dangeroustalk.net/?p=1889

              2. Chimps “the world over” speak the same language… lol. Chimps don’t live the world over. They live in Africa and South America. They lived basically in the same area of the world and were separated when the tectonic plates shifted separating the continents.

              3. You can’t speak chimp and you have no way of knowing whether they speak the same language, have different dialects, or have completely different languages all together.

            107. The truth is that DNA cannot be replicated in a Lab from scratch. Why not? The components to recreate DNA must be “alive”. Furthermore, matter cannot create information. DNA is a code with intelligent information, not being capable of being reproduced – even today – in a Lab. (Cloning is not creating from scratch btw).

              DNA was not some randomness of the universe…. not possible…. The Code in all living “things” came from an intelligent source…. more intelligent than we could ever be – thus futile in trying to understand it… but our arrogance will try to continue…which is fine, because as the most famous (once) atheist Anthony Flew said, “I will go where the evidence leads me”…. “The new DNA evidence have made me a believer in a creator”. http://www.bible.ca/tracks/converted-to-creation-antony-flew-former-atheist.htm

            108. First off, Antony Flew never said that: http://www.dangeroustalk.net/?p=968

              Second, if all you have to go with is the God of the Gaps, then you are in for a rude awakening at some point down the road because those gaps are getting smaller and smaller all the time.

              Third, DNA is not randomness. It is a product of evolution via natural selection.

              Forth, what do you mean “from scratch?” In cooking it means that something is made from basic ingredients and not from a pre-prepared product that just needs a few added ingredients and some cooking. Under that definition, then cloning would be from scratch. But you seem to be claiming that it means from nothing and as Dr. Krauss has pointed out, even nothing is actually something. You are just scientifically illiterate.

            109. Sorry, nope (well accually to create anything from “scratch” would require the creation of an entire universe, which is probably not what you were thinking of, but I digress), read http://blogs.plos.org/dnascience/2013/10/10/how-craig-venter-created-life/ , thank you.

              Random? That’s just a strawman.

              Not possible? Really? Can you tell the difference?

              Here is a 538 base DNA Sequence
              ATTCGTTACCTACGCTCTCGGTTTCCCCTGCGCCAAGTCTATATT
              CTCTAAAGACTATGGTTCCCGGGCAGGCGCCAATTAGGGTGATC
              CATTGCCCATGCCCCTCATGCAAAATTGCGCCCAGTCGGATTCA
              GTT CCG CGG CGA CAG AAC CAA ACA TGT GCG TAC TAC ACC GCT ATC ATT ACG CCT GAA AAC TGT GTT AGC GTC AGA TAC GTC GAA CCG GGT CTA CTG GTG AGC ACC GTA CCA CCC TCA AGA TTG ATT ACA ATA CCC GCT AAA ATG GGA CAC AAT ACC AAC GTA CG TTA GTC ACT TTG CTC TCG TCA GCA GCC TTG ATG GAG GCA CCT CTA ACA CGG TCG TGA CAT ACT TGA GAT AAA TTA CGA CGT ACC AGA TCG AAC GTC CCC GTA CCG TAG TCG ACA ACA AGT ACT TCT TGT GCG CCG GCG TTC ATG CGG ACC AAC TCT TGA ACA GCA GCG ATT CTC TAA GAA CAT AGA AAA AGA CAT CTA GGA TCC AGG TGA AAC TTC GAG CAG AAA GTG GAA CGG ATT G
              Here is a538 base mRNA sequence (basically replace the U with T)
              AUGGUGCUGUCUC CUGCCGACAAGACCAACGUC AAGGCCGCCU GGGGCAAGGUUGGCGCGCACGCUGGCGAGU AUGGUGCGGAGGCCCUGGAGAGGAUGUUCCUGUCCUUCCCCACCACCAAGACCUACUUCCCGCACUUCGA CCUGAGCCACGGCUCUGCCCAGGUUAAGGGCCACGGCAAGAAGGUGGCCG ACGCGCUGACCAACGCCGUGGCGCACGUGGACGACAUGCCCAACGCGCUG UCCGCCCUGAGCGACCUGCACGCGCACAAGCUUCGGGUGGACCCGGUCAA CUUCAAGCUCCUAAGCCACUGCCUGCUGGUGACCCUGGCCGCCCACCUCC CCGCCGAGUUCACCCCUGCGGUGCACGCCUCCCUGGACAAGUUCCUGGCU UCUGUGAGCACCGUGCUGACCUCCAAAUACCGUUAAGCUGGAGCCUCGGU AGCAGUUCCUCCUGCCAGAUGGGCCUCCCAACGGGCCCUCCUCCCCUCCU UGCACCGGCCCUUCCUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC

            110. Hmm, I thought it was Lenin or Marx that said religion was the opium of the masses.

              Yes, Jesse got to be governor, somehow, of Minnesota, but for advice of anything more serious than wrestling, I’d rather not lay much store in.

              Regarding the ‘book’ or books mentioned earlier, many folks grasp at anything that will give them hope, whether its value is proven or not. I remember a number of years ago folks going to Mexico for some particular treatment not available in the USA, supposedly as an alternative way to fight cancer.

              I do know of clinical trials at the University of Pennsylvania that have had remarkable success.

              I daresay that in a few more years, our children or their children will think of us a Barbarians with how we fight cancer now, much like we think of how people 100 years ago treated the mentally challenged.

            111. I agree with you that the way we fight cancer now sucks and hundreds of years from now this will look pretty barbaric, but for right now, it is all we have. One thing is for certain though, Chemo will look barbaric because science will find a much better way to treat cancer. It won’t be because prayers started to work all of a sudden. The faster religion stops blocking scientific funding and progress the faster we will have better cures for diseases like cancer.

            112. prayer works, when my middle child was born with a hole in her heart the size of a dime and all the doctors told us she could not and would not live, Even though I was raised as a christian, I was not a good christian, I never practiced my religion or went to church but somewhere I remembered that Jesus said “ask and I will give it to you, or something like that. When we got home from the hospital, I went straight to my room got down on both knees and asked Jesus for her life. Within 3 months the hole in her heart closed half way her doctor Dr Saul Robinson every time he saw her told us it was a miracle that happened to her, every single time he told us that. She is 46 years old today and the hole in her heart is closed completely. Since then I have had many prayers answered.

            113. *Facepalm* So what about all the people who prayed that their child, family member, or friend would survive and they died? Did God just not love them? How do you know it was your prayer that healed your daughter? Maybe it was the jelly donuts you ate that morning?

              Doctors are awesome at what they do, but the human body does heal itself and doctors can’t always predict how someone’s body will react. If your doctor told you that your child was definitely going to die, then you had a shitty doctor. Doctors shouldn’t say that. They should say that your child probably will not survive.

              I had a friend growing up who had a rare illness. The doctors told his parents when he was born that he probably would not survive past 6 months. When he was older, he went into a coma and the doctors said that he probably wouldn’t come out of it. Over the course of his life he went through several of those comas and each time the doctors didn’t think he would survive. He died at the age of 38. That was a much longer life than he was expected to live, but it was no miracle. He had great doctors and a strong immune system. He was lucky and had a great attitude toward life. Even though we fought a lot about pretty much everything (surprisingly not religion), I miss him and think of him a lot. But don’t tell me that God wanted him to die and don’t tell me that it was a miracle that he lived as long as he did. Why didn’t he live longer? Life is what it is. No rain dance will make it rain.

            114. Surviving or not life on earth is not a measure of God’s love – it’s life in the afterworld – in Heaven that matters. To access that realm we must abide by the law of God….

            115. Look doctors will say everything accordingly …Even they may pronounce the death according to stages … butttt one thing humans(ie Doctors) cannot decide anything… See God has purpose on each and every person he gives d word to us unless its being fulfilled we will not die and nothing takes us to hell or heaven,,, there is a time for everything… God says we humans have to face trials, temptation etc etc in this world but when these times when we lift our hearts towards christ almighty he gives strength to overcome this…

            116. Look we pray to god okay well and good but we should pray to god with trust and faith that god alone could do this … if u dont have this then nothing happens … and plzzz dont expect for miracles … nd on other hand we have to pray and fast to break d curse upon our family which comes heridity passing over generation to generation….

            117. Good fricken LAWD; you are such a friggin ASS. AND… full of shit!!! You just besmirch people constantly!! And you make shit up out of whole cloth – nearly in every single post!! — When you can’t win the debate, condescension is king.

            118. I’m not sure I could say it is “all we have”. There is a documentary in YouTube called “The Gerson Miracle”…. It is worth looking into it. Apparently many have gone to this clinic and have been cured…. They claim that they have cured thousands. Do I fully believe it? I don’t have the evidence at hand, but it is worth looking into it.

              I also just saw a show in Netflix about Joan of Arc…. it explained in scientific terms how having faith in God allows people to access parts of the brain – for health reasons – that atheist or non believers can’t access.

              The study is done by Doctors – PHds – researchers in Boston University. They placed volunteers in an MRI machine to measure brain response and activity – then applied small amounts of electric shock to them while showing them religious figures. The believers in most cases experienced less pain and a part of their brain lit up – that did not happen in the atheist brain.

              This experiment doesn’t prove God, but it proves that spiritual people have the ability to access more of the brain for their benefit.

            119. On the contrary, it is very exciting, very stimulating intellectual journeying, with, in my case, a somewhat high amount of testing the data I have gleaned from scripture. So, you learn to pray to seek the Intelligence that is higher than your own, and frankly, uncorrupted. Then you journal the ‘prayer requests’ that you pray, knowing the character of ‘The One True God’ as evidenced in the Bible, including the Greek Bible, Josephus’ ancient history, and archeological finds. Then, so your answers aren’t just accepted as a part of ongoing life, you go back and revisit your journaled prayers and read the date, writing the date of the answer next to the dated entry.

              Try praying with a young child, in an attitude of thankfulness for what you have received as well as your current request. Children of believers often have a very strong faith because when they are young, they have not been immersed fully in analytical thinking. When my son was young, he and I prayed together.

              I hate to say it, but it is true, that I wasn’t just ‘playing the system’ when I prayed with this child, because there IS a special presence when two or more believers pray together. We had some answers to prayer that were nothing short of amazing…one in particular, where the very next day the very words I had said came out of someone’s mouth at my job, offering me a position with the specifics my son and I had prayed for! (I had intended to leave the building immediately after work to apply elsewhere, but there was no need! The person came walking up with what I needed, a definite surprise. Children don’t doubt. They just accept truths and run with it. That is why in my son’s life I answered every question, even personal questions, truthfully, except one. I told him about ‘the Easter bunny’, ‘Santa’, the tooth fairy, and that my VW rabbit backfired so much because every time it backfired, a little jackrabbit shot out the tailpipe. Other than that, I was straightforward with my very intelligent little guy.

              He grew up praying about things and having prayers answered. It was just natural for him.

              Possible answers are 3– (1.) Yes (2) No (3) Wait. But the ‘Yes’ answers were often so full of specifics that we had prayed for, that it was truly encouraging, and FUN!

              Some people discover diamonds in streams, some discover new planets, some discover the patterns and experiences that cause a person think in a bizarre manner, others work to discover the cause of a disease, or a means to cure the disease.

              I personally enjoy exploring the spiritual. If there is a precedent in the Bible, I want to see how it works in my life. ISTJ personalities love to naturally analyze and sense and judge their environments. But more FUN to me than any other kind of exploration is to see how the spiritual works. Eg. how prophecy from the Bible can be filled on 2 or even 3 levels, all at the same time! How some principles always work in human connection. How eg. an attitude or approach of arrogance toward what I call ‘The Almighty’ but you might call ‘The great I Am’ or Yahwh or Yah, keeps communication from happening. So many keys, so much to explore, and much of it useful and translatable to daily life. Practical.

              But exciting elements too.

              I had a very intuitive father who taught me deep and analytical things of the Bible, concepts that many had not heard of. So you can imagine my chagrin when I excitedly told that mathematics and science teacher one of my son’s and my exciting and rather amazing answers to prayer. His response? ‘You can’t prove that!’

              I am not a liar, so I had to think, after he responded that way twice (and I never told him about our answers to prayer again.) I am musical, I have had things published, my mind works differently from how my father’s did.

              So God dealt with me in a way that worked with my mind and my son’s. My father, being a math and science teacher, and having very low self confidence and feeling, I believe, more afraid of the absolute power of God than trusting and believing in him as Jesus called him, ‘Abba Father’ which means Daddy. I understood that the Creator may well deal with different minds in different ways, and teach different minds in different ways.

              Just as a friend who 40 years ago was an extreme alcoholic, lost all his desire to drink when he surrendered to the Son of God as his Lord and Savior, but did not judge those who had to struggle for years to quit, I too, see that each individual’s mind and way to relate is different. So, just as I realized my father’s diligence in deep study into the original Greek and his interest in eschatology and study of future things appealed to his analytical mind, my mind required love and a touch of the miraculous. By the way, my father’s studies have stood me in good stead, as I am not ‘happy’ about, but definitely not ‘surprised at’ the events unfolding in the nations of the world today. This includes Russia flexing its muscles and orchestrating land grabs.

            120. Children shouldn’t be having such things forced upon them. They should be left to form their own opinions when they’re old enough to do so. Josephus’s account of Jesus incidentally is a known forgery. The ONLY evidence for the existence of Jesus is the bible, much of which is demonstrably false making it a less than credible source of history.

            121. How much hahaha research have you done. How many papers has your self admitted intellectually lazy self published on your extensive research on everything from the big bang to evolution to haha hahaha oh wait u were told All that in school hahaha

            122. religion is for the “intellectually lazy”, like Francis Collins, head of the Human Genome Project? Guillermo Gonzales, astrophysicist? or John Polkinghorne, theoretical physicist? Intellectually lazy like those guys, and many more scientists who are believers? Do you know what you are talking about?

            123. Well, if you knew the great minds among the Christians, you would have to change your views on that topic. You obviously only view people through your own limited, myopic lens. People of faith actually do much more research into their area of interest than you people do who call us weak-minded or “intellectually lazy.” You should actually get to know some very intelligent Christians, of which there are millions, if not billions. However, you make your own choices, and you reap your own benefits/consequences. I suppose Jesse Ventura knows so much more on this topic, since he was a wrestler. (Don’t make me laugh! People who follow him and those of his former profession are the intellects of the world, I suppose.)

            124. Rodd, your quote was not Dangerous, but another Christian going by the username “Me” trying to mock atheists and the author.

            125. Actually the mod didn’t say that, it was a person with the name “Me.” Don’t forget to double check things like that before you start criticizing people.

            126. Actually, Rodd, it wasn’t “Dangerous Talk” who said that; it was someone who calls himself/herself “Me.” They were poking fun at Dangerous Talk, who actually invited it with his ridicule of both God and His followers, and of homeopathists, who use His natural/spiritual means of healing us.

            127. Dangerous Talk say’s he did have faith once. And then God didn’t come down from the Heavens in a clap of lighting and appear to him….solve all his problems, cure all his disease, move the mountains for him, drive demons out of people right in front of him…..immediately because “HE CAN”. So, he got angry and decided he would try to convert as many people as he can to be atheists…..boy, look at all the people just on this site that find his unconvincing skills, rude, condescending, insulting etc. There is a right way and wrong way to debate with people. He has no idea whats so ever on how to do this…..The bottom line here is. He laughs at us Christians when he makes us mad, belittles us that Christians are suppose to be loving and Christlike. What dangerous Talk doesn’t understand and never will is…..when he attacks and belittles our GOD…..we will fight for Him. If that means getting a little nasty…..oh well. As long as it’s not threatening….we will fight like hell for Him. Dangerous Talks debating techniques are anything but convincing. They are only anger, belittle and insult who we are as people and believers. I think actually there is probably many atheists that are very classy debaters that would read his posts and inform him that how he is going about trying to inform people of his research etc. is never going to convince people of anything. Just anger them and put more of a “bad label” for all atheists. Find these atheists Dangerous Talk and try and get some pointers from them. I’m sure their out there…..and would probably love to help you find a way to get your message across in a respectable way that people would want to at least listen to and have possible debates with you that could end with people just agreeing to disagree. And you know what? That’s ok when a debate ends that way……it really is.

            128. Well there YOU go with making accusations and assumptions with Michelle being a believer of atheists being horrible and evil people. Way to go back on what you just said. Not too bright.

            129. OMG, what’s that sound I’m hearing?? It’s like a giant SUCKING sound!! Is that you CRYING like a little girl?? Because you are SO DESPERATELY losing the argument? And SO, SO quickly into this thing?? HAHAHAHA!!!! LMFAO, you FOOL.

              And SEE??? You just proved my point!! (that you’re a friggin’ IDIOT) You said that “you know that Michele believes that all atheists are…”. You obviously don’t have 1/2 the intellect that you only WISH you had, as intellectual people NEVER assume such RUBBISH. You do NOT know Michele, and she did NOT inform you that she felt ANY SUCH THING. You, in your infinite RETARDATION, only SPECULATED such NONSENSE. — That’s enough for now. I win BIG-TIME – making you look like a mental midget, and IMMEDIATELY. You are SOOOOO easy. Hey; let me give you some advice, you STUPID FOOL; (I read this somewhere VERY recently); “you should try to understand where I am coming from and have an actual
              conversation with me before turning me into the caricature you”-r sick and twisted and uber-DUMB mind simply fabricated out of thin air.

            130. Hear, hear, Dangerous Talk. As a person who was raised Christian, was an ordained minister, studied numerous other religions including Judaism, Khabbalah, Druidism, and others, and am now an atheist, I can say from personal exploration of religion and God(s), that I am a happier more fulfilled person now that I am free from the shackles and blinders of religion. You have my support, and those who oppose us have only their own fears, and their fear of there not being a conscious afterlife to which they will go and see all their family and loved ones again. It IS a scary thought that this life is ALL we have and that there is NO “Heaven” which we are going to to continue “living”. But in reality, this is the way it is… THIS life is ALL we get. Make the most of it, live life to the fullest, because there are no second chances, no conscious afterlife where we are being rewarded or punished for our deeds through our life.
              Cheers to you D.T., and here is to you and yours.
              May you live a long and healthy life.
              A. Bear

            131. All your defensive arguments portray exactly what you’re trying to keep yourself from admitting. I’ve never seen a person commit so much lamentation, so willingly, while they defend themselves confusingly through tireless synonyms. Weird.

            132. It’s the same thing as calling someone a clueless idiot. Here’s a copy of your quote, verbatim. Read it back to yourself and see what it sounds like to someone else.

              You assumed that person you wrote this comment to was ignorant. How do you know he/she is ignorant and has no knowledge of the topic at hand without knowing that person? Do you know him/her and all the facts about his/her entire life? That’s an arrogant assumption at best, something atheists make frequently. Get off your high horse and do a little Bible reading, something you apparently have not done without your prejudice behind it. Try doing it with the objective of actually “learning something,” as you put it. Try doing it with a little humility instead of arrogance, as if you know more than your creator.

              “Dangerous Talk Mod flagirl336 • a year ago

              I have actually written several articles on morality in the Atheism 101 section of this website. You should check it out because you clearly have no idea what you are talking about and you might learn something.

              Yes, atheists base everything on facts not faith. You say that like it’s a bad thing. It isn’t”

            133. Yeah, Michelle… You might want to expand your mind and actually use reason and logic in your life. You might actually learn something if you research things using sources that are based on evidence rather than a book of fairy tales.

            134. I agree with your statement. Christians don’t think they are Better then Atheists because Atheists are Ignorance of God.
              Christians are just more knowledgeable about Spiritual and Moral subjects.

            135. Wow! So you are saying that slavery, rape, and genocide are moral? Because that is what the Bible says and if you get your superior moral knowledge from the Bible, that must be what you believe, right? Which one of God’s top ten rules forbids slavery or rape? None. Which one outlaws working on Saturday? Worshiping a different deity? Talk about priorities.

            136. God isn’t saying that slavery, rape or genocide are moral but he are correct that he doesn’t explicit condemn them either. In order to argue that something is moral you would have to argue that it was commanded to do it (that it would be a sin to disobey). That is the definition of morality in a religious context: not all that is permitted is moral but all that is not permitted is immoral. All that is required is moral but not all that allowed is immoral. For most things, God simply does not say anything one way or another.

              Now all of this discussion goes out the window when it comes to God-REQUIRED genocide, rape and slavery, all of which *do* occur in the Bible but in each of these cases, they are contextual and are applicable only to certain situations, all of which occurred in the past and are not relevant in the present for the purposes of morality (in other words, God can order you to do something that would otherwise be immoral because, well, He’s God, which is why your constant harping that torture is never moral does not hold water, not to mention that it is a dangerous position to take).

              As to the rest, there is actually nothing that says that you cannot work on the Sabbath. As to which day is the Sabbath, that was a decision that was made by Christians or Jews, not by God. There is nothing in the Bible that says that the Sabbath cannot be Wednesday (for example).

              On the other hand, worshipping a different deity after you have already chosen to worship Him? Well, God’s name is Jealous:

              “You must worship no other gods, for the LORD, whose very name is Jealous, is a God who is jealous about his relationship with you.” (Exodus 34:14)

              In any case, if you are going to argue with Christians remember that pretty much ALL of your objections are subsumed under Jesus’s pronouncement about the two most important commandments. Sure the most important is to love God (ahead of everything else) but the second one was to love your neighbor as you loved yourself. To Jesus everything else was commentary. Okay, so maybe God appears to the unenlightened human (and we are all unenlightened in God’s eyes) to be a bit full of himself but hey, He’s the Creator, his “very name is Jealous” and He is entitled to be that way and, as His creations, we have no right to question His will or His commandments. However, like children are wont to do with parental rules (and God does call us His “children”), we can bend them (both in a positive and a negative way) so long as they don’t break. In fact, we are supposed to do just that by using our faculty of reasoning to make sound judgments about His will.

              Peace Be Upon You.

            137. “In order to argue that something is moral you would have to argue that it was commanded to do it (that it would be a sin to disobey).” What? I don’t know where you get your definitions from but this one is pretty absurd. It is moral to help an old lady cross the street, but that doesn’t mean that we MUST help all old ladies cross every street and that it would be a sin to not help an old lady cross the street. Aristotle had a lot to say about morality and he was just the beginning. There is an entire branch of philosophy dealing with morality that you should really look into. While I can’t speak about the Koran, I can say that the Bible absolutely does promote the view that slavery, rape, genocide, and treating women as property. These are moral and God does command them. Islam also has a rather poor history with their treatment of women and their eagerness toward violence.

              “applicable only to certain situations” I call Bullshit on this one. There are no disclaimers in the Bible that say slavery, rape, and genocide are only okay in this particular situation and even if it did (which it doesn’t) slavery, rape, and genocide ARE NEVER ACCEPTABLE!!! Please provide one situation where you believe rape to be acceptable. I call Bullshit!

              My position that not torturing people is dangerous? What would you call your position that people should be tortured? All in good fun? I’m sorry, but it seems that your sense of morality is completely screwed up. You morality is relative to the whims of a deity you aren’t even claiming exists and you can’t know what that deity’s whims even are. I wrote an Atheism 101 article on this: http://www.examiner.com/article/atheism-101-is-there-moral-grounding-without-god

              “…there is actually nothing that says that you cannot work on the Sabbath.” See the Fourth Commandment. God wrote that shit in stone because it was so important that he didn’t want it to ever change. He literally wrote that law in stone according to the Bible.

              “God’s name is Jealous” Let’s think about this for a moment. If you could create only ten moral laws for all of humanity, would one of them be to worship you and only you? Would that really be a moral law? Doesn’t that seem a little petty to you? A little vain? Maybe even a bit like a dictator? For one thing, you aren’t even claiming that God exists remember, so how can you turn around and claim that God is jealous? That’s just your opinion, man. My opinion is that Oden is a jealous. Oden said he would defeat all the Frost Giants and you don’t see any of them walking around, do you? Oden therefore kicks Allah’s ass.

              Jesus also said that he did not come to change the law, but to fulfill it. He didn’t want to change any of it. He supported the whole of the law.

              “He is entitled to be that way” Why? Why is he entitled to be “that” way? That sounds a lot like a dictator to me. You don’t get it. Morality is not the relativistic whim of a deity that you aren’t even claiming actually exists. If God were to tell you to murder your child, would you do it? If morality is merely God’s whim, then you absolutely should without any hesitation at all. But if part of you hesitates even for a moment because you think that murdering your own child might be immoral, then clearly your morality isn’t coming from God’s relativistic whim. Clearly you have a sense of morality that tells you that murdering your own child just might be immoral even if God commands it. Morality isn’t about God (mainly because God doesn’t actually exist and we both agree on that).

            138. ” I don’t know where you get your definitions from but this one is pretty absurd. It is moral to help an old lady cross the street, but that doesn’t mean that we MUST help all old ladies cross every street and that it would be a sin to not help an old lady cross the street.”

              You are reading it out of context. I was addressing your CLAIM that God is saying that slavery, rape, and genocide are moral. The ONLY WAY you can claim that is if God REQUIRES us to engage in those activities.

              You do state that (and you continue to state that) even though God DOES NOT command us to do those things any more (as to when he did command those things, I pointed out that they were CONTEXTUAL — don’t forget that “morality” changes over time — slavery used to be considered MORAL but now it doesn’t so that pretty much obliterates your statement that “slavery” was never acceptable!). Your changing definitions of morality (slavery is an EXCELLENT example of that!) is EXACTLY THE PROBLEM with atheists. In a thousand years, you may decide that it is IMMORAL for heterosexuals to marry and then where would we be?

            139. Morality doesn’t change. Our understanding of morality changes. We are learning what is moral and hopefully we are refining our sense of morality so that we will continue to learn what is moral better. Morality is based on human empathy, compassion, and well-being. As we extend out empathy, our sense of morality changes, but morality itself remains the same. We are just discovering what is most moral.

            140. By the way, I agree that I cannot prove that God exists. As to the Sabbath, I should have put that in quotation marks. Sorry about that. My point is that there is nothing that says that you cannot work on the “Sabbath” as defined by Christians or Jews since the Sabbath could easily be Wednesday (since the day of week is never defined). You know it is pretty good idea, however, to have one day of rest every seven days. You need some time for fun!

              Oh, and I do not state that Odin isn’t real. If you start attacking Odinism (which is a legitimate religion), I will defend them as well (as best I can).

              As to the question of morality. Morality is not the relativistic whim of man either. It is immutable. That is why slavery can’t be immoral since mankind has practiced it for tens of thousands of years. Just because it isn’t immoral doesn’t make it moral and it doesn’t make it right, however. It just isn’t up there in the list of morality. Indeed, all that is moral from the standpoint of man comes down to one concept and ONE concept only:

              Do unto others as you (in the same situation) would have done unto you (in the same situation). If you are okay with being a slave, then you can go ahead and have slaves (provided it is legal)–and in the days of the Old Testament, people used to sell THEMSELVES into slavery, so it must have been okay with them. If you are okay with being killed in a certain situation (if I break into your house and physically threatened you and your family using a deadly instrument, I would consider it acceptable for you to kill me), that is why self-defense in moral. Rape is only moral if you consider it acceptable to be raped in the same circumstances. When God tells people in warfare that God commands (I can’t remember the Bible verse but He does do that in the Bible) to engage in genocide and rape, then Christians cannot complain that it happens to them in the same circumstance (apparently God thinks that it is acceptable when God orders it — therefore, Christians and Jews have to accept it when God orders it against THEM). That is probably one good reason why in the Qu’ran there is NO commandment ever to lay waste to the entirety of a nation (though we admittedly did go a bit far, we only killed those of combatant age and were not commanded to women and children). We certainly didn’t go down to killing infants and even livestock as one Bible verse commanded of the Jews.

              Also, slavery may be allowed but it isn’t encouraged in either the Bible and it certainly isn’t encouraged in the Qu’ran. The Qu’ran actually strongly suggests (but admittedly never requires except as a lawful punishment of the slave owner) that slave owners give up their slaves. That doesn’t make slavery right but it doesn’t make it immoral.

              Furthermore, EVEN THE US CONSTITUTION does not condemn slavery in all circumstances. Read the 13th Amendment carefully, it DOESN’T abolish slavery:

              “Neither slavery nor involuntary servitude, except as a punishment for crime whereof the party shall have been duly convicted, shall exist within the United States, or any place subject to their jurisdiction.”

              Thus, if Congress wanted to do so, they could make all prisoners slaves (though they could not make their descendants slaves). Hmm… Don’t you think you have better things to do than outlaw religion (like eliminate that glaring problem with the US Constitution)?

              Peace Be Upon You.

            141. Why do I get sucked back into this?

              Either Odin exists or he doesn’t. He can’t both exist an not exist at the same time in the same way. This is basic logic. Do you believe Odin exists or do you lack the belief that Odin exists. Again, you can’t both believe and lack belief at the same time and the same way. This is a binary question.

              Slavery is immoral. It cannot be both moral and immoral in the same way at the same time.

              Finally, I have stated multiple times that I have no desire to outlaw religion. I support the free market of ideas in which all ideas and beliefs should be open to criticism and critical thinking. I do not want to murder those who disagree with me nor do I want to imprison them. These are the attitudes of religious believers. I want to destroy bad ideas by exposing those ideas as being inaccurate and immoral and by presenting better ideas.

            142. The reason why you keep getting back into this is because you keep denying an essential truth: an objective claim MUST be falsifiable. It is the essence of the definition. You also keep on misunderstanding what “existence” means to a theist because you are an atheist.
              Let’s get down to the core of the disagreement:

              1) You submit that Odin does not exist in objective reality. I concur since if he did exist in objective reality, it should be possible to prove him.

              2) I submit that Odin still might exist (I just do not know) but he does not exist in objective reality.

              3) You cannot construct a falsifiable argument regarding Odin. Therefore, you cannot prove the existence or nonexistence of Odin.

              4) Odin rid the world of frost giants. If frost giants existed and we found one, that would disprove Odin.

              5) The problem is that we have not found any frost giants or any evidence that they ever existed. The reason for it may be that they never existed (your perspective) or they did (the Odinist perspective).

              Now on to the part of our disagreement. You have stated that slavery is immoral. I agree that it most cases it isn’t (but not universally) but you cannot prove it objectively for all moral standards. Morality is subjective. The only universal law that I have seen adopted by all is: Do Unto Others As You Would Have Others Do Unto You.

              SLAVERY IS MORAL (in at least one instance)!!!!!

              Let me illustrate a case where slavery IS moral. Suppose that I will die unless I am given a cure. The only way to get that cure is to become a slave of a kind individual. Therefore, I would contract to be the slave of that individual. How is this not a moral action if I agree of my own free will to become a slave? Now the reason why it is immoral from a theist perspective is that my life is not my own. Therefore, since I do not have ownership over my life (my life belongs to God), I cannot sell myself into slavery. However, how can you argue otherwise being an atheist?

              TORTURE IS MORAL (in at least one instance)!!!!

              Similarly, torture IS moral in a similar circumstance. If you were to offer me a cure that would save the life of my family, all of whom are dying of an otherwise non-curable disease, in exchange for the right for you to torture me for 5 minutes (remember, you said that torture for even 5 minutes is immoral and that there are NO exceptions), then I would submit that it was perfectly moral for this contract to occur. Again, I freely am entering into the contract. There is no morality issue here.

              The reason why Allah can torture me for all eternity is because my soul belongs to Allah. I am His property and willingly entered into that contract when I affirmed that I was a Muslim when I became an adult. So I have to assume that slavery is moral and so does every other Abrahamic theist (Jew, Christian, and Muslim) so long as we are willingly submitting to God’s will.

              This is not a question of accuracy or immorality. There is no accuracy as to the idea. There is no immorality as to the idea. There very well might be a better way but you keep forgetting that we believe in God. If God exists, disbelieving in Him sends us to Hellfire. If He doesn’t exist, it doesn’t matter. Although you cannot see the logic of Pascal’s Wager as it applies to the believer, the logic is airtight (from the perspective of the believer). Remember, to poke holes in it, you MUST place yourself in the position of being a believer, NOT in your own position. Similarly, from the perspective of an atheist, it is definitely immoral to become a theist, since you would then be God’s property. However, morality is relative to which position you are in and that is the problem you need to break through if you want to create atheists out of believers. You can’t simply ask us to not believe. You are either (a) required to PROVE that God does not exist (which you admittedly cannot do since you cannot prove non-existence); (b) that God’s threat is not credible (almost as impossible of a task though we theologians have already come up with many rebuttals to the “God cannot be just if He tortures” argument and, in any case, this is a subjective opinion anyway); or (c) PROVE that it would be better to be free for, say, 100 years, and tortured for all eternity after that rather than enslaved by a kind master for all of eternity (again, a subjective claim). In other words, all “objective proof” to a theist is pure poppycock. You need to deal with OUR subjective reality, not objective reality, to sway a believer.

              By the way, I commend you on not trying to outlaw religion. You would be a very BAD dictator but I still submit that you are, at heart, a pretty decent guy (who is misguidedly trying to impose his will on others through an illogical argument that you keep arguing is logical).

              Your call.

            143. I NEVER SAID THAT “GOD DOESN’T ACTUALLY EXIST” AND WE DON’T AGREE ON THAT. Instead, we can agree that “God has NO corporal presence that can be detected scientifically and thus does not exist IN OBJECTIVE REALITY.” That represents my position and it also represents YOUR position although you would go further and suppose that means He doesn’t exist at all.

              Other things, however, also cannot be detected scientifically and thus do not exist in objective reality: love, justice, morality are three PERFECT examples. That doesn’t mean that the don’t exist!!!!

            144. Again, we have gone through this multiple times before. You don’t understand what the word “objective” means!!!!

              Second, you are making a category error when you compare God to love, justice, morality, etc.

              Third, as I also stated before, we can actually test love in a laboratory. We generally don’t, but we have and we can. We can test justice as fairness in a laboratory and we have determined that chimps and babies as young as 18 months old have a sense of justice as fairness. Sam Harris talks about morality and how science can inform morality in his book, “The Moral Landscape.” So all the things you listed we can actually examine scientifically in an objective way. But you don’t understand what the word “objective” means so I don’t know what to tell you.

              Either God exists or he doesn’t. I am claiming that there is no reason to believe that he exists and that he almost certainly doesn’t. You are claiming that he exists subjectively and that he subjectively created the universe. As I pointed out before, we share the universe so there can be no subjective creation of the universe. It is an objective claim. Either God created the universe or he didn’t. He couldn’t have created it for you and not created it for me. That doesn’t make any sense. You can say that we can’t know one way or the other, but that too is a objective claim. It is also a reason to reject that objective claim since there is no reason to support it.

            145. Good day viewer,i want to use this opportunity to shear my testimony to everyone on this forum, my name is joy from Alabama USA, I have been suffering from HIV/Aids for over 5years now,my family and friends left because of the sickness. i have spent all the money i have to make sure i get well again,but there was no solution.until last month January 20th 2014, I came in contact with a traditional doctor also known as a chief priest on a newspaper who is called Dr favor who has help so much people to cure their HIV aids and different kind of disease, firstly i taught it was a joke,i never believe him,i just contact him to know if he can reeling help me or not.i email him,and he reply me and said that if i am ready for this work and i told him yes, and he collected my details and told me that,he will take to his gods for solution, after he has finished consulting his oracle he will let me know,and tell me how he is going to carrying on with the casting of the HIV disease out of life.after he have finish casting the disease,he told what to do and i obey him.he told me to go for a medical check up,and i did,to my greatness surprise i find out that I was not with any HIV disease anymore, my friends and families who left me before run back to me. I now found out that God in Heaven is using this man to bless and heal us all, he is a great and powerful man, again I say to you sir, that God almighty will uplift you and your great work you did for I and other people. Pl i will sincerely advice all HIV patient to contact this great powerful man called Dr favor for your solutions now at ‘favorspiritualspellcasttemple@outlook.com he will help you on your HIV problems and any kinds of diseases with is spiritual power and his tradition herb.if will have up to ten people like him,no body will suffer this disease again…email:’favorspiritualspellcasttemple@outlook.com this are the work he also do?Kideny problem,all kinds of cancer problems,heart problem,diabeties,and it can also brng back your ex lover that have left you for many year,Bacterial Vaginosis

              Candidiasis/Thrush

              Chlamydia

              Crabs/Public Lice

              Genital Warts/HPV

              Gonorrhea

              Hepatitis A/B/C

              Genital Herpes

              HIV/Human Immunodeficiency Virus

              Non gonococcal urethritis (Mycoplasma/Ureaplasma)

              Syphillis

              Trichomoniasis

            146. Why does every widely known religion that was worshipped BEFORE Christianity have a specific name for their God? Why is it that after thousands of years of failed attempts to push religion onto people they decide to give up and simply call HIM ‘God’? Why is God called the Holy Father? Why is it that women can’t preach? Why was a woman held accountable for the sins of Adam? From a young age you hear that everything that ever was or will be is associated with a man figure with limitless power and mercy. I know this, in MOST Christian homes(As well as many Muslim households) women are beneath men. The Bible, if anything, was written as anecdotal guide which contains not examples of truth, but of experiences. Hell, anyone with enough influence and wealth could write anything they wanted into it… It’s a big ass journal of life experiences and anecdotes. Children’s stories…

            147. Ridiculous, your mind is riddled with insidious hooks of an unfounded faith based on nothing more than simple bullshit. Christians think that morality and spirituality are two things bound together, they are NOT. Religion was a simple mind trap designed to control people, but you can’t understand that because you are unwilling to under any circumstances shift your perspective beyond the bars of your mental prison.

              Athiests don’t THINK they are better than Christians, as a rule, they just have better things to do than ride a high horse and be a pretentious asshole until they read commentary like this garbage diatribe of extremely weak in fact unsubstantiated claims to your delusions of grandeur.

              As a matter of point most Christians think that Athiests are Satanists.

              It is about time you SAVE YOURSELF.

            148. List all the disproven facts in the bible please? Leave out any theories such as evolution, big bang, dark matter, genetic expression and all other unproven and ultimately fraudulent claims that are now force fed as factfact for no reason… Read the book that mentions that the earth simply must not be In an advantageous position in the center of the universe because it simply can’t… Do a little research about how science failed to get diabetes And cholesterol under control how no matter what we do cancer increases… Evolution especially take the preying mantis… The female takes the males head so he can ejaculate how did that evolve? Did she begin rip his head off first or did that become his preferred method first? The odds of it occurring simultaneously randomly and perfectly paired are astronmical. Furthermore the further back you go.. We as humans are more like worms than worms are like one celled organisms.. The jump from worm to human would be easier to make than bacteria to worm.. If ur science can explain that.. And the gap from RNA to bacteria is even less likely.. And beyond that the odds that a pile of elements made RNA is almost impossible.. Even if the world was 500 trillion years old.. Look up those odds and then argue.. And seriously atheists just cut the shit how do Christians bother u so much? What did we do to you that you must hate us so? If the whole world were like what a wonderful place it would be? Everyone trying to be smarter and better than anyone who disagrees? GMOs and cancer rampant? U don’t make any sense… Why would u not want to live forever and love your fellow humans? Why would you not want to be in a close committed relationship? imagine a world where no one helps anyone.. An old man falls and everyone runs over laughing kicking him but he’s weak he’s of no use so he can go feed the worms.. No one can marry cuz sex is all that matters. No one loves anyone or anything anymore and people won’t even leave basic freedoms alone like personal beliefs. And honestly most scientists would agree that science is being pushed now almost like a new religion.. Oh and why is it that u can be Hindu Buddhist Muslim pagan even satanists and u don’t get the same look of hate and oh my god another one as u do if your christian.. Yes every religion is right except Christianity? It’s all in the bible we will be hated for his name sake… If you have eyes let u see and ears let u hear.. For Satan stalks like a lion seeking whom he may devour.

            149. I don’t need to.. I went to college.. All the “facts” are little more than theories and hypothesis with little to no proof.. I went a staunch atheist and was very very disappointed. And argue a little better than facepalm haha what a cop out..

            150. Do you? Cuz its not scientific law. Do you understand? And it was one of the top 5 science schools in Boston competes directly with MIT.. I’m guessing you are not a scientist or ud know a law from a theory.

            151. I don’t think you understand the difference between a scientific law and a scientific theory because they aren’t even dealing with the same thing. Let me help you out on this one: “[scientific] Laws differ from scientific theories in that they do not posit a mechanism or explanation of phenomena: they are merely distillations of the results of repeated observation.” – Wikipedia

              Scientific Theories like Gravity, the Big Bang, Evolution, etc. are pretty solid stuff. They aren’t mere guesses made by people in white lab coats. But you probably know that seeing as you went to such a top science school and all. 😉

            152. http://en.m.wikipedia.org/wiki/Newton's_law_of_universal_gravitation

              But that’s just a theory? U really are building a house of cards here.. Held a certain way they look like bricks but..
              And that’s because a law is proven and no longer offering suggestions but is now founded and moved out of the realm of theory.. Yes scientific theories are taken As fact but they aren’t really. I’ll play your game then.. When I see video of the big bang or u show me the monkey before or after Lucy or the organism that split from the others … Cause they can find the first one and the next groups but not the organism that actually split into what became our animal kingdoms… I find that odd.. And u really are just hateful condescending and spiteful and have no idea what ur talking about.. U read books regurgitate what u read and don’t even understand it.. Also in college they discourage the use of Wikipedia as it is not the most reliable source.. But this theory of gravity is in fact a law that describes a universal system.. Ur applying meaning to the word Theory that actual means scientific theory and confusing a scientific theory with the scientific law.. Such as the law of universal gravity.. And creationism is still taught in college as a real honest theory that must be possible because we do not know for certain that it’s not.. If anything your type is the cancer all my points are valid and stand beside yours in the scientific community.. You have literally no solid book learning.. U actually people tried to build a ladder to heaven.. If u had any clue ud know more about this.. So u could at least argue effectively. “Ur confusing a theory with a scientific theory”. There is no such thing as just ” a theory ” in science.. It MUST be scientific.. U need to study more before u try hurling things u read on Wikipedia around.

            153. Simple fact is if u put the solar system at the center u don’t need all these other theories such as the red shift cosmic expansion, according to Russian mathematicians, based on the layout of the universe its more likely that all matter was stacked in a single line not a point. Also creationism as much as u hate to believe it.. Is still a theory. Yes that is true… Barring one becoming law with absolute proof.. Creationism is still a theory as are more ridiculous ones..furthermore our universe at any one time only follows two out of three proposed laws for existence.. The reaction is not always equal or opposite.. and there are many others.

            154. Thats ur opinion… Fact is science cannot rule it out so yes it is the creationist theory.. There’s big bang theory, spontaneous combustion theory, creation theory, Rick James ejaculating into the primordial ooze

            155. And see what I did there teaching you instead of “oh u didn’t go to a good school gwahahaha”

            156. As a man who once had faith I assume u know that u are a lamb in the flock and Jesus is your shepherd. When a lamb strays no matter how far the shepherd follows. Through the thorns and brambles… When you are at your worst he will bring you back. He will never leave you. Try to have faith once more and you will see.

            157. I want to apologize… Ur not argueing anymore And I feel a little bad. To be fair I’m just tired of people belittling only Christianity. Nowhere in your article are any other religions mentioned. Why is it that those are all OK but no one can be christian? That should tell you something.. The darkness cannot abide the Light and vice versa. Also I’m not trying to make you look stupid and want you to understand the difference that when Christians try to enlighten they firmly believe they are saving a life. Atheists could just sit quietly or post scientific articles about what they believe not make websites about religions that are stupid in their minds. It serves no purpose. But know that I’m not trying to be offensive or make anyone feel inferior… That is the last thing on a christian agenda or should be anyways. But im sorry for taking up so much of your time and space on this website. And sorry for debating there was probably a better way to get my message across to you. But enjoy this fine day that the lord hath made;). Maybe well speak again.

            158. Wait, wait, what? Why didn’t I mention any other religions when talking about a Christian scam artist? Maybe because the particular story I am talking about dealt with Christianity!!! In any case, this seems like a argument I have already addressed in the Atheism 101 series: http://www.examiner.com/article/atheism-101-why-do-atheists-only-focus-on-christianity

              As for your other claim, I don’t think religious believers are stupid. I think you are wrong and dangerously so. I think your beliefs are hurting society. They are a threat to human happiness, human progress and even human survival on this planet. I’m not trying to save your life, I’m trying to save everyone else’s.

            159. Love your neighbor as yourself, do not kill, be faithful to your spouse, give freely to those in need, forgive and turn the other cheek is detrimental and dangerous to society? And what morals did u arrogantly set in atheism 101 oh prophet of atheism.. Teach us your ways so that we can be more like u and save the world from ignorance and moral dilemma.

            160. Read my comment about the medical community and their “science” and the natural health community that actually seeks to get to the CAUSE of a disease or malady rather than masking it with MEDICINE. The medical community is exactly what its name implies: medicating rather than curing. Even your so-called “knowledge” can be misdirected. The knowledge of God is wisdom, and since you don’t know Him, so you’d do well to steer clear of making comments about an area in which you have no knowledge. In the natural world, it’s said that “seeing is believing.” However, the exact opposite is true in the spiritual world, in which believing is seeing. One truly sees after he has believed.

            161. What will you do with the educators who also have faith? There are plenty of them, and they are far wiser and, therefore, more knowledgeable in the true sense of the word. You atheists act like atheism has a corner on science.

            162. just got this months old email today. it must be making the rounds again and here I am late as usual. oh well, judge not lest ye be judged? you miss that part? seems so when you were judging him for his beliefs. you sought to chastise and ridicule an atheist as opposed to convert him to christianity. you chose to mock him and drive him further away. have you ever read the book in question???? Seriously, you’re getting it wrong there bubba..
              I’m an atheist myself but at least I know wtf a christian is supposed to be. you missed the mark by a mile. well, unless you’re just a troll. then, spot on.

            163. Not sure how I was “judging” him. I just understood his statement to be proving her point. It made me laugh. The fact that he got defensive and accused me of attacking him was sort of out of left field in my opinion. It was by no means an attack. And tell me what a Christian is “supposed to be”. Above all you should understand that we are, all of us, human beings, exquisitely flawed. I don’t look down my nose at people. It’s not my style. I choose to find humor in the passionate arguments that people make against faith and God. In my heart I don’t believe in atheists. I believe in an all-powerful, indescribable, uncontainable Heavenly Father who loves all of His Creation whether they believe He exists or not. In the light of that belief, how could I possibly judge my fellow human beings?

            164. According to the Bible, that “all-powerful, indescribable, uncontainable Heavenly Father who loves all of His Creation” has judged that everyone who doesn’t believe he exists will be and should be tortured for all eternity (which is a pretty long time). If you believe this deity is correct, then you are approving of the torturing of all non-Christians for all eternity. Do you approve of this or do you stand against your deity?

            165. I wasn’t talking to you. You shouldn’t butt into conversations. It’s rude. 😛 But in all seriousness, there’s really not a point in responding, is there? You’ve demonstrated time and again that you will shoot down pretty much anything that anyone says because you believe yourself to be right. My words will not change your mind. Would you agree that we could take any given topic and seeing it from 2 different perspectives would give it 2 different opinions? The way that you describe the God that you don’t believe exists is, in MY opinion, twisted and jaded. My perspective is that God is Holy and therefore repels sin like an opposing magnetic force. You say He wants to torture people. That is a lie. He loves and wants everyone to join Him for eternity. Our sin is what keeps us from His presence. And that applies to everyone, “Christians” and “non-Christians”. We sin, therefore we cannot be in the presence of a Holy God. This was heartbreaking and unacceptable to Him as He longs to know us and to be known by us, so He sacrificed Himself on the cross in order to wash away our sins with His pure and Holy blood, forever negating the need to sacrifice “perfect” animals’ blood to cover sins. This is why I refer to the Bible as a love story. The entire book, if understood correctly, paints a picture of eternal love that knows no bounds. There are very few people that I would like to see tortured for all eternity, and if I myself being human and flawed can’t conceive of that, how much more does it break the heart of God to have the people that He created and breathed life into, choose to not believe in Him? This world goes on and on and on, and we who believe long for His return. We want to leave this earth and join Him in heaven, but He waits and delays day after day in order to give everyone the chance to simply accept His gift of forgiveness. That’s my perspective.

            166. First, it is my blog so I’m not “butting in.”
              Second, Of course I think I’m right and that is why I am arguing for my position. You think you are right too. If you didn’t, you wouldn’t be arguing for your position. But you are wrong if you think that I am not willing to change my position. I am. I have changed my position on a host of important issues including the existance of an all-powerful deity. If you make a good argument or present some valid evidnece, I am all too willing to change my position. I have done it before and I am willing to do it again. Are you willing to change your position?

              There are many alleged gods and I don’t believe in any of them. The God of the Bible is among the most abhorant. I don’t say that he wants to torture people, the Bible does. Those who don’t believe in his existance on insufficient evidence and who don’t worship him will be tortured for all eternity in Hell. According to Jesus, it is better to pluck out your eyes and chop off your hands if they cause you to sin than to have your soul tortured for all eternity.

              I maintain that no finite crime deserves infinite torture. Not only that, but that no finite crime even deserves finite torture. Torture is immoral, period. It is immoral to torture someone for five minutes and it is immoral to torture someone for all eternity. So according the Jesus, God is immoral.

              I don’t think you understand what “all-powerful” means. If God is all-powerful than he has no Kyptonite. Sin is not God’s Kyptonite. He has no Kyptonite. If God wanted us to be in his presence, then it would be the case. He is after all, all-powerful.

              God is not a vampire; he does not need blood. Why would an all-powerful deity need anything, anyway. Killing an innocent lamb as an atonement for wrong-doing is not moral. Two wrongs do not make a right. So I reject the whole eleborate scheme.

              That’s really a problem for Christianity; your God is too all-powerful for your own mythology. Christians are always telling me what God can’t do or how God has to have these elaborate schemes in order to fix the problems he created. But none of that makes any sense. If God is all-powerful and he wants everyone to be “saved” or whatever, then it would be the case. No need for blood sacrifices, no need for Jesus, the resurection, etc., and no need for people to do anything at all. There would be no suffering in the world and no one would ever get sick or hurt in any way. But the fact is that we do live in a world in which people suffer and die all the time. We do live in a world where our perfectly designed bodies aren’t so perfectly designed after all. We do live in a world that seems in every sense to not have been perfectly designed at all. It is a world where human beings are only able to see a very small sliver of the light spectrum (and that is with 20/20 eye sight) because our eyes suck. Dogs can hear so much better than humans. Why is that? Why weren’t our ears perfectly designed to hear as well or better than the ears of a dog?

              My point is that all the evidence points to the obvious fact that the Bible is a series of fictional books written by main anonymous authors who didn’t know squat about how the world actually works. Now sure, we don’t know everything about how the world works either, but we have learned a great deal about how the world works in the past 2000 years and we are continuing to learn through the scientific method. Still, we have learned enough to know that the Bible authors were wrong about a great many things.

              I’m excited that we live in a time where we have people using the scientific method to understand the world. We are learning new things everyday and through science we are making life better for all human beings. Take the flu for example. You can pray to your God that you won’t get the flu, but it would be more benifical for you be diligent about washing your hands and to get the flu vaccine because science works. Think about it.

            167. I was kidding about the “butting in”. Hence the “:P”. No, I’m not willing to change my position. I’ve spent too many years being right and knowing it. Haha

              I do have to point out that the Bible does NOT say that He WANTS to torture people. I’m sorry, it just doesn’t. And also to clarify, I never said that sin is God’s Kryptonite. It is not Kryptonite for Him. It doesn’t make Him weak. HE is SINS kryptonite. It cannot survive in His presence, hence WE could not survive in His presence without the forgiveness of our sins.

              You do have a point on the whole blood thing. I’ve never understood that one myself. I’m not so sure that it’s the blood itself that matters. Just the fact that God came to die in our place for our sins so that we don’t have to. You know like, we can’t survive in His presence with the sin in our lives, but this way He took on those sins so that they would be cancelled out if we choose to believe. The whole animal sacrifice thing was way creepy. I agree. I wouldn’t agree with it being immoral back then though because God asked for it and He’s not immoral.

              I appreciate you taking the time to explain your point of view more. It’s always good to get other perspectives. :)

            168. I don’t blame religious believers for being uncomfortable with the concept of Hell. You should feel uncomfortable about it. Eternal torture for finite transgressions is horrific. This is why many religious believers have attempted to redefine Hell to be some sort of Heaven. Seriously though, Jesus made it very clear that Hell was a really bad place and that it was better to pluck out your eyes and cut off your hands than it would be for your entire body and soul to be in Hell. So while I don’t think he used the word “torture” that was certainly implied and other books of the Bible support that view of Hell. For the record, the Old Testament does not speak of Hell.

              The fascination with blood is really creepy, weird, and doesn’t make any real sense. One issue I have with your comment though is that you are claiming that it would have been moral back then because God asked for it and he obviously isn’t immoral. I don’t think that is very obvious. If God said it was okay to torture people then God would be immoral. Torturing people doesn’t become moral because God commands it so. Morality doesn’t work that way.

              If God were to suddenly decide that rape was morally okay or even desirable, it wouldn’t make it so. We know rape is morally wrong not because there is a commandment that says, “Thou shall not rape” because there is no such commandment. No, we know it is wrong because we feel empathy for other people and we can imagine how it someone might feel if they were raped. We know that would be an unpleasant experience to say the least and therefore we reason that it is immoral.

            169. Perhaps you misunderstood. I didn’t say that Hell is not going to be torture. I said that God doesn’t WANT that for anyone. Hence the coming to die in our place so we don’t have to go there.

              As far as animal sacrifice being immoral, well, I don’t consider killing animals to be immoral. To compare that to torturing people and rape is, in my opinion, quite a stretch. I love animals but I don’t believe them to be equal to humans. That’s probably another debate entirely. I was simply stating that I don’t fully understand what God’s point was in having people sacrifice animals to Him. I suspect that it was meant as foreshadowing.

            170. I don’t believe animals are equal to humans either — mainly because I’m a human. If I were an animal, I might think differently. 😉 Seriously though, I was talking about sacrifices. I think killing an animal for no good reason (i.e. a ritual sacrifice) is immoral.

              But my main issue is with your first paragraph here. You claim that Hell is going to be torture and that God doesn’t want that for anyone. Well, then I guess it is a good thing that your God is all-powerful then. Because being all-powerful, if he doesn’t want something to be the case, then he can just make it not the case. If God doesn’t want anyone to go to Hell, then *finger snap* no one goes to Hell. Problem solved.

              The things is that your deity is too all-powerful for your own mythology. Why does God need this elaborate scheme of impregnating a virgin, waiting 33 years and blood sacrificing the kid, and demanding that everyone must believe a bunch of ridiculous stories on insufficient evidence in order to avoid Hell when God could just *poof* make it happen. Isn’t he God? Can’t he do whatever he wants? If he wants us not to go to Hell to be tortured for all eternity, then why the elaborate scheme? Why the creepy fascination with blood sacrifices? It’s poor story telling if you ask me. It is a huge, gaping plot hole in the narrative. Don’t you think?

            171. Well obviously I’m rather intrigued with the story telling actually, lol, but I get where you’re coming from. These are questions I’ve asked as well over the years. Yeah sure God could snap His fingers and save everyone from Hell. And who knows, maybe in the end that’s exactly what He’ll do. I believe that Judgement Day hasn’t arrived yet. I believe He’s giving everyone a chance to repent and believe. But here’s the thing. If what I believe is true. If God is real and loves like we do, but better, then how could He snap His fingers and MAKE us all believe? Did you ever see the movie “Bruce Almighty”? There’s a line in there that KILLS me every time I watch it. When Jim Carey says to Morgan Freeman, “How do you MAKE someone love you?!” and Morgan says, “If you figure that one out, let me know.” See, it’s not that He CAN’T do it, it’s that He won’t take away our free will. It’s not love if we don’t choose it. He doesn’t want robots to do His bidding “as programmed”. That’s not love. He says, “Here’s the Story. Here’s the Truth. Believe or don’t believe. I’ll be right here whenever you’re ready.”

            172. Do you think it is moral to watch someone suffer when you could help them? Do you think it would make you more or less moral if you could help them at any time, but decide to wait and watch them suffer for a long while first? Wouldn’t that be a little sadistic?

              Do you believe that the North Korean dictator Kim Jong Un is real? Do you love? Would it take away from your free will to love him or not if you didn’t know if he existed or not?

              My point here is that it wouldn’t take away from my free will (if that even exists and for the record there is strong evidence that it doesn’t), if I knew that God existed. If God were to show himself to me, I could still allegedly freely decide to either love him or not — and based on the account in the Bible, I probably would not.

              How can God make someone love him? He’s God. He can do anything. While as a human, I can’t make another human love me, I am also not an all-powerful deity. Again, the problem is that you are thinking about God as if he wasn’t all-powerful. Religious believers tend to be really quick to tell me what their all-powerful deity can’t do, which is very strange because you all just got done telling me that he is all-powerful and can do anything.

            173. Okay, we’re going in circles here. I’m saying He COULD force us to love Him, but He won’t because He wants us to choose to love Him. You keep saying that I’M saying that He can’t. Not true. He can do anything and everything. He IS all-powerful. I don’t think of Him in any other way.

              You think that it’s immoral to let someone suffer if we can help them? You can’t judge that. Not being able to see the entire picture of someone’s life, you don’t know if the suffering is something that is necessary for their future well-being. God CAN see the big picture, and though it hurts Him to see us suffer, it is certainly not immoral for Him to allow trials to shape us into more mature and stronger people. Just like, as a parent, at times I have to step back and let my kids learn something the hard way because it will build their character and teach them something that only a little pain can teach.

              I’m sorry that the “religious believers” you’ve met seem to think that there are things that God can’t do. That’s just wrong. I’m not “religious”. I haven’t been to church in ages, though I admit to feeling guilty about that. Lol I don’t spend time every day reading my Bible “religiously”. I just believe in, have faith in, and have a relationship with God that’s sometimes hard to put into words because it’s so personal and so close to my heart.

            174. When people suffer before they die, there is no lesson they are going to learn. They are going to die! How many countless children suffer and die so that, what, they might learn some lesson at the moment of death? Or are they mere pawns so that someone else can learn some lesson? Is that how Christians think of suffering children?

              The problem is that God isn’t a parent. When I allow my 5-year-old to suffer through something so that he can learn a lesson, it is because I don’t have any other way of teaching him that lesson. But if I could just get him to learn the lesson without having him suffer to learn it, I would do that in a second. God being all-powerful and all, can do that. My point here is that for humans there is a “no pain, no gain” method of education, but God could simply give us the gain without the pain. Again, he is all-powerful. Why can’t he do that? Why can’t he make his existence known to us? He God desires us to love him, then why isn’t that the case? God allegedly all-powerful.

              You say you agree that he is all-powerful, but you don’t actually ascribe him that characteristic.

            175. Again, He IS all-powerful. He is also all-knowing, unlike you or me. You’re judging His choices for us as if you know better than He does how things SHOULD be handled. We’re all guilty of that from time to time, but you seem to be making it your life’s mission to teach people that you know better than God. I know you don’t see things that way because you’d rather believe that He doesn’t exist. Please stop telling me what I don’t “actually ascribe” to Him. You think that He should stop all pain and suffering. You call Him immoral for not doing that. You think that anyone who doesn’t have all the answers for you is just foolish for believing in His love and power.

              How are you gonna sit there and tell me that God isn’t a parent? He is God, THE FATHER, who sent His ONLY son to die. Again, you don’t want to believe that He exists and yet you’re trying to redefine who He is to back up your disgust with Him. He IS a parent. He created all things, therefore being the ultimate parent for all living things.

              As for “why can’t He make His existence known to us”? Are you serious?! You wouldn’t believe Him if He stood in front of you and said, “Hey, it’s Me. God. Nice to meet ya.” You’d find some way to scientifically explain it all away. For those of us who have eyes to see, His existence is evident everywhere we look. I know His presence like I know myself. And what’s more, I promise you that if He suddenly wasn’t around you, you’d notice. The fact that you are even having this dialog with me, means that He is attempting to get through your thick, stubborn skull because He knows that I know He exists, AND He knows that I’m stubborn and compassionate enough to keep telling you how much He loves you regardless of your supposed indifference. You think that it would show more love if He just “made His presence known” to you? It would make things so much easier? IF it would make things easier, that’s probably exactly what He would do. I’m guessing that it wouldn’t be the case for YOU in particular. You need to learn a different way in order to make Him “real” to you. Study C.S. Lewis. Brilliant man. Used to be an atheist.

            176. Please argue why gravity is a theory and not a law cuz according to your Wikipedia it newtons law of universal gravity and it describes the process by which a system ie gravity functions in our universe… Cuz u ignore all my valid points and don’t refute them.. And u just said gravity is a theory and can’t be a law cuz a law is just distillation of blah blah blah… And a theory is what posits or offers an explanation.. Then once that theory is tested repeatedly across all possible scenarios and is repeatedly correct.. It becomes drumroll please a law.. That breaks down or distills the data garnerned from experiments such that the system is explained through the data. Just so next time u have this Convo you don’t look as foolish..

            177. If it is a fact, then it has already been proven correct. If it is a really solid scientific theory, then I accept it until new evidence comes to light showing that it is incorrect. I don’t accept it on faith, I accept it on the solid scientific evidence which has made it a theory. But I am glad that we can both agree that faith is a very bad thing. So we are making progress.

            178. Now why is faith a bad thing. Don’t you have faith in your family? How about when you go to work everyday, don’t you have faith your car will run. Don’t you have faith that God isn’t real? Faith is a very big part of life.

            179. So ok, correct me if I am wrong, you don’t say I have faith in my mother, you say I have science in my mother?

            180. Look up the word trust in the dictionary, trust means certainty, belief, FAITH, assurance, confidence. Trust implies unquestioning belief and reliance upon something or someone.
              Now look up the word Faith in the dictionary. It says the same, Confidence, belief, trust. actually it says unshakable and unquestioning belief upon someone or something. And you are saying you don’t believe in Faith but you believe in Trust, I have to salute you for that good way to avoid Faith by slipping in the word Trust. To bad the words faith and trust actually mean the same thing. If you trust in someone you have faith in someone and vice versa.

            181. You have an odd reading of dictionary. A word doesn’t mean all the definitions at once, it means different things in different contexts. Trust in this context is confidence and assurance. It does not mean unshakable and unquestioning confidence and trust. No, trust can be shaken and questioned. That is a huge difference between the two terms.

            182. tell us the facts you have that God does not exist. You have no facts, it’s only faith you have that God does not exist.

            183. Tell me the facts you have that the Easter Bunny does not exist. You have no facts, it’s only faith you have that the Easter Bunny does not exist. Therefore you must believe the Easter Bunny is real. You see, you can do that with anything. That is why in logic, the burden of proof is on the one asserting the positive claim. I don’t have to believe anything on insufficient evidence. Present the evidence or admit that there is no basis for your claim.

            184. same goes for you present your evidence or admit there is no basis for your claim. I get it you believe the earth was created by the Big Bang and you believe that created all the order in the world today. Here is a good way to test that theory, go out and throw a few grenades in your back yard and blow them all up and just see how much order it creates. Even Albert Einstein who atheist love to claim as an atheist said the more he studied the Cosmos the more he believed a supreme being created it all. He also said “science without religion is lame and religion without science is blind”

            185. Actually, just last week evidence was found that supports the Big Bang Theory even more. But if you want a science lesson about the Big Bang and the evidence we have for it prior to the most recent discovery, you should watch Lawrence Kruass talk about the Universe From Nothing on YouTube. I think there is an hour version of the talk out there or you can watch the full two hour version.

              Einstein was a naturalist who did not believe in a personified deity. He believed in what has been called “Spinoza’s God” which is to say he doesn’t really believe in any supernatural deity at all. Christians love to take quotes that Einstein said early in his live and then make a claim that he held dogmatically to those beliefs all his life. The fact is that as a scientist, Einstein was extremely critical of religion and the religious were extremely hateful of him. But he grew up Jewish and there is a strong cultural connection for Jews. So he probably considered himself Jewish for much of his life even though he rejected the supernatural beliefs of that religion.

              Still, even if he did believe in a deity (which he didn’t), that wouldn’t make such a deity real. Smart people can and do believe in ridiculous claims on insufficient reasons all the time. The fact is that there is a great deal of evidence in support of the Big Bang Theory and zero in support of a supernatural deity. BTW, even the Pope accepts that the Big Bang actually happened. So I can play the same game you are trying to play. However, his opinion doesn’t mean anything unless the evidence actually supports it and in this case the overwhelming evidence supports the Big Bang.

            186. I believe the best scientific evidence points to the Big Bang Theory. And, I have faith that God caused it.

            187. Do you have any evidence that your god or any other deity caused it? Maybe Oden caused it or perhaps it was the FSM. Right now, the evidence suggests that it probably had no cause in our universe. But I’m happy to say that I don’t know what “caused” it, if anything did cause it. I feel comfortable admitting that we don’t have all the answers rather than just making up an answer and holding to that answer on faith.

            188. Einstein didn’t say that early in his life he said it later in his life, he said the more he studied the Cosmos the more he believed a supreme being created it all. Yes I know Einstein was raised a Jew. And I am not saying the Big Bang is not real but it is only a theory No one knows how the world started, they are all just theories. I will say it again, look at all the order in the world, do you really believe that all just happened by accident? Just study the body alone, how the body works. Use your common sense, Common sense will tell you NO that didn’t happen by accident.

            189. I get it you don’t believe in God, and I do believe in God. You believe in Science, well do you know many of those Scientists you believe in believed in God? Issac Newton he was a theologian and wrote more on religion than he did on science. I can give you a long list of scientists who believe in a supreme being but you can also look it up yourself on the internet. Einstein was raised a Jew, and that sticks with you throughout life, even though you wander away in your younger years many times they always come back in their older years. If you read Einsteins quotes about God, you can see that. Ever heard the term, there are no atheists in a foxhole? Also I’ve lived a long time and through out my days science as well as medical science said one thing at one time and later changed it to another thing. I’m not saying the Big Bang isn’t real, I don’t know how the world was created, But if it was caused by the Big Bang, it had to be a pretty intelligent Big Bang, because of all the order in the world.

            190. Wow, you certainly put a lot on the table here. 93% of the Scientists of the National Academy of Science don’t believe in deities. Second, the real question is how do scientists derive their scientific knowledge? From the Bible or from the scientific method? I think you will find the latter to be the case. The very fact that we are communicating shows that science works. Does the Bible give detailed instructions on how to create the internet? Did God impart that knowledge through direct revelation or did smart scientists use the scientific method to figure it out? Einstein was a Jew, but he kicked his religion to the curb, just as I did: http://en.wikipedia.org/wiki/Religious_views_of_Albert_Einstein

              No atheists in the foxholes? Tell that to Pat Tillman and all the other atheists in the foxholes. There are actually a few organizations of them. That is pretty strong evidence against your claim that none exist.

              If the Big Bang happened? It happened. That is a fact and the fact that you don’t know that is very telling about how little you value the science you use and depend on every day.

            191. “Tell me the facts you have that the Easter Bunny does not exist. You have no facts, it’s only faith you have that the Easter Bunny does not exist. Therefore you must believe the Easter Bunny is real.”

              “Tell me the facts you have that the Easter Bunny does exist. You have no facts, it’s only faith you have that the Easter Bunny does exist. Therefore, you must believe Easter Bunny is not real.”

              Both of these statements are identical in terms of logic and both are illogical. The conclusions do not follow from the propositions.

              This is another example of how atheists (and theists) are completely illogical when they both claim knowledge (and denial of existence *is* a claim of knowledge) about something for which no knowledge is possible (whether God exists). The ONLY proper statement from the theist is: I do not know if God exists but I believe that God exists for subjective rather than objective reasons. The ONLY proper staements from the atheist is: i do not know if God does not exist but I believe that God exists for subjective rather than objective reasons.

              That is because EVERY SINGLE PROOF that can be offered up for God is subjective in nature. Here are the “proofs” that atheists have offered up to demonstrate “proof” that THEY would believe to cause them to change their mind about whether God exists:

              God should contradict some physical law of the universe to prove His existence:
              Refutation: God does not wish to offer proof to those who refuse to believe.

              God should contradict logic to prove His existence:
              Refutation: http://carm.org/atheist-says-there-no-evidence-god

              God should reveal Himself to prove His existence to me:
              Refutation: Would destroy free will, which is the purpose of mankind being on the Earth in the first place.
              Science can prove that God exists IF God exists:
              Refutation: If God is all-powerful then he can certainly fool scientists.

              If you have no evidence, you should have no belief:
              Refutation: There used to be no evidence that germs caused disease, that the Earth revolved around the sun and that there are no canals on Mars (indeed, the evidence seemed to suggest that there WERE Martian canals!). Each of these statements were later proven correct.

              Okay, so therefore if there can be no evidence, you should have no belief:
              Refutation: There are some things that have absolutely no evidence that we MUST believe. These axioms are required for us to have any discussion at all. For example, there is no evidence that there is a natural explanation for everything in the universe but rather it is a basic operating principle of science without which no scientific inquiry can occur (the key operating phrase here is “everything” — even if you can prove that nearly everything has a natural explanation, there might be something that does not and you could never find out that it does not because you will alawys be looking for the natural explanation and dismiss any other possibility).

              In other words, the reason the atheist cannot see God is becasue the atheist ASSUMES God away in the first instance. That is fine as an operating principle for science but assuming something does not exist does NOT mean that it does not exist. This is the atheist conundrum. They take their ASSUMPTION and then go a step further to claim KNOWLEDGE. That’s just intellectually dishonest (just like the theist who does the same when she takes the ASSUMPTION that God exists and then claims KNOWLEDGE). Theists need to stop arguing over which flavor of ice cream is better and atheists need to stop arguing that ice cream does not exist.

            192. I read that article and it doesn’t address my claim. My claim ISN’T that God exists and you have to prove that He doesn’t. It is that you can’t prove that God doesn’t exist AND you can’t prove that He does exist. Since I make no claim of knowledge of God’s existence and have already stated that you do not have to prove that God does not exist, I am absolved from having to prove that he exists. Both claims (that God exists and God does not exist) are equally fallacious since God cannot be proven. Where we disagree is what that means as to belief but our disagreement is pure opinion and NOT fact. When you elevate it to telling me that God DOES NOT exist, you are making the claim, not I. End of lesson.

            193. Valid is in the eye of the beholder so I will take it that you mean “objective” evidence when you say “valid” claim. In any case, you are correct ONLY for those who currently do not believe. In other words, if there is no valid evidence to support tthe claim then there is no reason to believe a claim that you do not currently hold.
              Similarly, if there is no valid evidence to deny the claim then there is no reason to believe that the claim is false and one must instead apply the “Does it do harm?” standard. Indeed, the placebo effect suggests strongly that your claim that God should not be believed is untenable since mere belief in God does no harm whatsoever (and could do some good). Analysis of individual deities and religions, however, may vary from this rule, which is why you should not become religions.
              But I digress.
              There is no valid (as in objective) evidence that mint chocolate chip ice cream tastes better than vanilla but it tastes better to me, therefore, I can make that claim but it only applies to my own subjective belief. You have no means to prove to me that mint chocolate chip ice cream does not taste better. This is mere opinion.
              If I choose to believe that mint chocolate chip ice cream, on the other hand, will cure someone of psychosis then we have the placebo issue. Back in the day when there was no treatment for psychosis, believing that eating mint chocolate chip ice cream would treat psychosis may have been a false belief but it was much better than practicing lobotomy, a procedure for which the originator actually won the Nobel Prize (perhaps the stuipidest awarding of the prize in history) since eating mint chocolate chip ice cream will do no harm, while having a lobotomy certain DOES cause harm! Today, if I refuse to prescribe anti-psychotic drugs in favor of telling patients to eat mint chocolate chip ice cream, I would be doing harm and so I should stop believing that eating mint chocolate chip ice cream is an effective treatment for psychosis. At the same time, it doesn’t mean that my patients shouldn’t eat mint chocolate chip ice cream, they just shouldn’t believe that it treats psychosis.
              Similarly, I should not believe that intercessional prayer will cure disease since there is not only no objective evidence to support the claim but there is actually objective evidence that does not support the claim. That does not mean that I shouldn’t pray for my own purposes. Meditation (including prayer) and other forms of introspection are demonstrably proven to aid in the mental well-being of the worshipper (or the meditator). Just because you don’t want to do so using a prayer does not mean that it isn’t beneficial from a subjective (rather than objective) standpoint.
              Indeed, for all you know, the only thing that is preventing me from hunting you down and punching you in the face is precisely my belief that God thinks that’s immoral (that and the possibility of punishment by temporal authorities, which you have earlier ALSO denied as being something that can reduce crime–how little you know about crime reduction!).
              Thus, it is perfectly acceptable to argue against individual practices of theists but since mere belief in God can do no harm (it probably does no good but it certainly does no harm) you should give it a rest on the “there is no God” hypothesis. He is not amused. So once again you are proven wrong. Amazing how bad your track record is on this point!
              Peace Be Upon You.

            194. How can you say it does no harm when you admit that your fellow Muslims would murder you for questioning your beliefs?

              Second, As I have already explained multiple times, you are making a claim about the nature of reality. You are not merely discussing your personal tastes. Unless someone has actual evidence to support their claim, there is no reason to accept the claim. So yes, if your claim cannot be supported with valid evidence, then it should be dismissed as false until valid evidence is presented.

              “for a ll you know, the only thing that is preventing me from hunting you down and punching you in the face is precisely my belief that God thinks that’s immoral…” Unfortunately the converse is also true. The very thing that causes your fellow Muslims to threaten to murder you for questioning belief is their belief that God thinks that it is their moral duty. I also addressed this point in the Atheism 101 series: http://www.examiner.com/atheism-in-national/atheism-101-is-religion-a-constraint-on-human-behavior

              So far, I have refuted every point you have made multiple times and you have admitted that God isn’t real. You have stated that you are not making a claim that God is real, but rather expressing your taste that you like a particular character in a particular book. You have made it clear multiple times that you are not making a claim that God actually exists. So you are really an atheist and you have stated that you are afraid to question the beliefs you were indoctrinated into out of fear that Muslims will murder you… but it is all my fault that Muslims will murder you because… I don’t really see how I am to blame for the actions of God believers who you claim can’t do any harm and yet are threatening to murder you for questioning your beliefs. Again, my track record is clear here. Your track record doesn’t really make any sense and I hope you are beginning to see that. Maybe instead of dogmatically holding to beliefs out of fear that you will be murdered by Muslims because of atheists, you will actually start thinking critically about your beliefs. If you aren’t willing to be introspective about your own position, then you really have a very arrogant position. Like I have stated before, I have changed my beliefs based on logic and reason and if you or anyone else could provide evidence for your claims, then I would be willing to change my beliefs again. That’s not arrogant. The position you stated that you will never changed your beliefs is an arrogant one.

            195. “How can you say it does no harm when you admit that your fellow Muslims would murder you for questioning your beliefs?”

              Because you are confusing mere belief in God with a particular belief in God. How many times do I have to explain to you that I am NOT making a claim about the nature of reality because I agree with you that God does NOT exist in objective reality in the physical sense nor does He interfere in it via miracles. You simple do not get it because you refuse to believe that it is possible to believe in something that lacks objective reality. Let me ask you this: do you believe in love? Do you believe in justice? Do you believe in fairness? NONE of these things have objective reality. Going further, do you believe in a conscience (note: I did not state “soul” since atheists mistakenly think that “soul” has to be part of objective reality when it doesn’t)? Do you believe in rationality? None of these things exist in objective reality. Yet, they exist. Why is it so hard for you to understand that God is EXACTLY the same thing.

              “Unfortunately the converse is also true. The very thing that causes your fellow Muslims to threaten to murder you for questioning belief is their belief that God thinks that it is their moral duty.”

              I agree but it is irrelevant. The reason they are threatening to murder me is because they (like you) do not understand that we should be free to believe whatever we want and, more importantly, it is absolutely and perfectly acceptable to do so since no harm can come by mere belief. It is not the belief that is the issue. It is always and only the action that comes from that belief (which is why you are so funny and so wrong to think that someone who merely thinks that you are going to hell is threatening you — if they tell you that they think you are going to hell, that is an action, which is morally wrong, not because they actually are threatening you but rather because they are hurting you with a lie (or in their case what they believe to be the truth but it still is hurtful to say such things). That is why I tell you that atheists are free to claim that God does not exist but they must realize that this is an OPINION, not a FACT, and, therefore, they are acting immorally by trying to get others to convert. You are no better in thought and only better in action when you tell theists that God does not exist than those who would cause me harm. Since it is the “thought that counts” according to you (a ridiculously absurd assertion), however, and not the action, I submit that by your own definition (not mine), you are evil. Change your definition or change your thoughts. Your actions, according to you (since it is the “thought that counts”) are irrelevant.

              You have never refuted any point. You simply are talking in circles because you don’t accept that others can have a different opinion. All I ask is that you have the same consideration for the opinions of others as your demand for yourself. If it is a fact that God does not exist, you should be vocal about your desire to throw into jail all God-fearing individuals who believe that atheists are going to Hell since (in your words, not mine and not their words) they are all threatening you. To not take actions against them by having them all jailed and to outlaw their religions when they represents a clear and present danger (from your perspective) is clearly illogical. I certainly would argue (and have argued) that jihadist Islam a la bin Laden and company should be outlawed because of its threat to others. Why are you so tolerant of those who “threaten you”? Do you not understand that mere thought can never constitute a threat unless it is put into action?

              Finally, let us deal with your biggest LIE: I have never admitted that God isn’t real. I have absolutely stated that God exists but he simply does not exist in objective reality. However, neither does love or reason or justice or fairness or your conscience yet all of these things are as real as you and I are. Learn to stop LYING about others and stop being so bloody arrogant since there is NO WAY THAT YOU CAN change your beliefs from an OBJECTIVE standpoint based on logic, reason and evidence because it is simply NOT possible to prove God that way.

              By the way, young one, it isn’t arrogance to state that I will never deny God. That is because God is like ice cream. I will never state that I do not like ice cream because I like ice cream and I prefer it to not having ice cream. That isn’t arrogance. That is experience from my subjective reality. There is NOTHING that will make me no longer like ice cream. Now I might find another flavor of ice cream that I would prefer to mint chocolate chip. That is possible. It is also possible that I might other things better than ice cream and thus I might not prefer eat ice cream any more but I will never lose the belief in God because the belief in God is like ice cream. In order for you to get me to not like ice cream, you would have to prove somehow something else is better because it offers me more. Since not having ice cream can never offer me anything that I cannot get from being able to have everything that isn’t ice cream PLUS the choice of ice cream (by definition, more choice is always better than less choice), there is simply NO REASON for me to change my position on ice cream. Similarly, we can discuss God. So, if you want to convert me, you have to convert me to something else. I would open to the Invisible Pink Unicorn, Pastafarianism, or Discordianism, all of which offer far more than atheism does. although I doubt as much as Islam promises.

              However, prove to you that God exists? That isn’t only not possible, one should run for the hills if someone states that it is possible because they are a charlatan. In conclusion, if you actually tell me that you will only change your beliefs if God is proven to exist and you actually DO change your beliefs when it is “proven” to you, then you are a fool — and I seriously doubt that you are a fool. Therefore, you are just supremely arrogant because you keep on insisting that your opinion is a fact and are thus EXACTLY like most theists in this regard.

            196. Yes, love, justice, faitness exist in the state of affairs! They are not physical but they exist. You are making a category error. You are claiming that the God exists in the state of affairs of the world in a non-physical way. This is NOT a subjective claim. It is an objective claim about the state of affairs. You are claiming that God created the universe not just your universe, but the objective universe. This is an objective claim and I am calling bullshit. God isn’t a verb.

              I believe you should be free to believe whatever you want. But if you believe someting that isn’t true, I will point out that it isn’t true. I will not threaten to murder you if you believe 2+2=7, but I will correct you and provide my reasoning why 2+2=4.

              Yes, actions come from belief and that is why incorrect beliefs can be dangerous. Your Muslim friends think that God wants them to murder you. They are wrong and that belief causes them to do bad things… like threaten to murder you.

              You are claiming that God does not exist. You keep stating that you are not making a claim for God’s existence. So we agree that God does not exist in reality.

              “Change your definition or change your thoughts.” This sentence perfectly describes your problem. You keep trying to change the difinition of words so that you can avoid dealing with the actual situation. If “God” is merely a subjective emotion, and you claim to feel that emotion, then it exists. But God isn’t a subjective emotion and for the record, emotions only seem subjective. We can actually test for them now in an objective manner. But that is besides the point. The point here is that you are trying to change the definitions of words so you can void having a rational discussion.

              Again other people can have a different opinion, but they cannot have different realities. 2+2=4 and even if you have a different opinion, that opinion is not going to be correct. 2+2=4 regardless of your different opinion.

              ” If it is a fact that God does not exist, you should be vocal about your desire to throw into jail all God-fearing individuals who believe that atheists are going to Hell since (in your words, not mine and not their words) they are all threatening you.” No I shouldn’t!!! That is what religious believers do. I am not to blame for the wrong doing of religious believers and I do not have to behave in an equally immoral manner as religious believers do. You are again blaming atheists for the wrong doing of religious believers and demanding that we be equally as immoral when we obviously aren’t.

              “To not take actions against them by having them all jailed and to outlaw their religions when they represents a clear and present danger (from your perspective) is clearly illogical.” Again, it isn’t because that will not actually stop religious belief. It is ineffective and immoral. Like I have said before multiple times, the best way to deal with the danger or religion is though education and criticial thinking. I attack the ideas, not the people holding those ideas. But you just want to blame atheists for the immoral actions of religious believers and project your own immorality on us.

              “Why are you so tolerant of those who “threaten you”?” Because tolerance is the most effective weapon against such beliefs. In the free market of ideas, ridiculous religious beliefs fail and die.

              If God doesn’t exist in objective reality, then he doesn’t exist. When we talk about existence we are talking about objective reality. I don’t think you understand what the terms “objective” and “subjective” actually mean. If you are claiming that God created the universe (not just your personal universe, but everyone’s universe) then you are making a objective claim. Subjective means that the state of affairs only applies to you. Liking an ice cream flavor is subjective because it is subject to your personal tastes. How the universe was created is objective because it applies to everyone.

              You are claiming that God created the universe and that God interveren in the universe pre-Muhammad. These are objective claims and they are not supported by the evidence.

            197. If that is the case, then YOU have now made an objective claim. Prove OBJECTIVELY that love, justice and fairness exist. I believe that they do but I also believe that you cannot objectively prove that they exist.

            198. Again… it isn’t about proof, it is about evidence!!!!
              Second, like I said before you are making a category error.
              Third, we can test someone’s feelings of love why measuring the what areas of brain light up when we expose a person to sensory impulses. This has been done under laboratory conditions.
              Justice as fairness was recently tested with chimps. Two chimps received a small amount of food and despite the small portion both were content. When one chimp then started to get a larger portion for no apparent reason, the other chimp got angry. There was more to the study, but you can Google it if you are interested (which I am sure you are not).

            199. 1. Where is your evidence that it is about evidence and not proof? Statements without supporting evidence are inadmissible. Besides, I gave you the definition of objective claim from two independent sources. Unless you have a definition of objective claim that differs from what I have given you and you can cite it, you have no evidence to support your assertion. By the way, the definition of objective claim is an objective claim since it is falsifiable. Since I gave you the definition and it fits what I say and categorically does not fit what you say, you are in error about the nature of objective claim and I am correct. This is not disputible unless you can find another definition somewhere else. Then we can discuss those definitions and whether we can commonly agree (if we don’t agree, you really cannot proceed logically with this line of argument).

              2. Where is your evidence of a category error? Statements without supporting evidence are inadmissible.

              3. I told you to prove OBJECTIVELY that these things exist. You are not doing that. You can’t start by assuming they exist and then proceed to provide “proof” that they exist — you are doing EXACTLY what theists do when they “prove” that God exists! No, to prove that love exists or justice or fairness in any objective sense, you must begin by assuming they don’t exist in any objective sense but you don’t do that.

              You can’t test people’s feelings of love without assuming that love exists in the first place. You have to first prove that love exists in an objective, not a subjective sense. I could just as easily show you that brain activity lights up when dealing with God. Same thing, different example. You can’t prove something exists by assuming that which you claim you can prove exists.

              Similarly, you can’t prove justice or fairness in any objective sense. What you are proving is that chimps have some feelings of fairness, which are predefined by the experiment as being “it is unfair for someone else to receive something for no apparent reason.” Fairness depends on the perception of the person. I am certain that the chimp that received the larger portion thought it was fair to receive it. Furthermore, not everyone universally feels that way. I don’t consider it unfair if you get something I do not get. The question of fairness never enters into my mind because I discern that there may be some other reason that I do not know. By the way, I have read that study.

              Look, I believe that love, fairness, and justice exist. However, we cannot prove any of them. Just like God. Oh, and no, it isn’t a category error. It would be a category error if I had claimed that God existed in a manner that can be proven somehow. But I didn’t. In fact, my definition of God dos not allow Him to be proven. It is illogical to require someone to prove something that they state cannot be proven. Quit being illogical. If you want to disprove me, you have to prove that the God that I have described cannot exist (not provide evidence, I need proof).

              Remember, I have evidence. I choose not to share it with you because I am not seeking to get you to believe that God exists. Furthermore, my evidence is subjective, so you wouldn’t believe it anyway, so why bother. Even worse, if I could get you to believe me (without proving it), I may be committing one of the worst sins imaginable. You see, it would be a sin for me to convert you to Islam without proof since you might later stop believing and that would open you up to Hellfire for once being a believer and then converting away from Islam (because as I said I do not have proof, I only have evidence). On the other hand, if I did provide proof, I would be sinning because proof provides compulsion and that violates the Quran’s prohibition against compelling people to believe. As a good person, I simply cannot have the possibility of you being consigned to Hellfire on my conscience. When, and if, you decide to become a Muslim and ask for guidance in a proper manner, Allah (swt) will open your heart and you will hear the truth. Until then, it is impossible to turn your heart and therefore it would be foolish of me (and possibly even evil of me) to even try.

              Peace Be Upon You.

            200. Ha Ha Ha… think he is HALFCOOKED … look nothing is impossible by my christ almighty he is the creator of universe … He is Alpha …. Omega even cancer fears for jesus… look stop thinking nd talking rubbish and start reading the Holy bible atleast once so that u’l trust nd ur doubts will be cleared ….
              Another one thing Even Satan trusts God Jesus but u ppl…Goddddd
              Stop doing u’r nonsence research on bible take d cross nd follow him…

            201. “You are claiming that the God exists in the state of affairs of the world in a non-physical way.”

              Define “state of affairs”. I claim that God does not exist in objective reality. That doesn’t mean that He doesn’t exist. It simply means that you cannot prove that He exists.

              The epistomatical burden of proof is exclusively reserved for a claim of knowledge. I make no such claim with regard to God.

              Russell’s Teapot, which is the position that you atheists assert that making scientifically unfalsifiable claims requires that the person making the claim prove it is not a good analogy for religion. Eric Reitan has pointed out that the teapot orbiting between Mars and Earth is verifiable, while God is not. You keep forgetting that I explicitly stated that God’s existence cannot be verified. In fact, Russell’s Teapot happens to be falsifiable since if I could theoretically scour the entire spectrum of space between Earth and Mars and when it was not found to exist, I would have falsified it. Thus Russell’s Teapot is not only an inapproprirate analogy but it is also illogical and should be consigned to the dustbin of history with other equally poor arguments. Furthermore, Paul Chamberlain has argued that forcing positive truth claims to have at a higher burden than negative truth claims is logically erroneous. Russell’s Teapot seems obvious to you because it is made up by Russell as a foil. However, I would go further. Any positive claim can be turned into a negative claim. It is a positive claim that “The Sun revolves around the Earth.” It is also a positive claim that “The Earth revolves around the Sun” but when it was first broached, it was as a negative claim as well (“The Sun does not revolve around the Earth”). Furthermore, it is absolutely possible to prove a negative true or false. The statement “There exists no prime numbers between 8 and 10″ is a negative existence claim but I can prove (by contradiction) that there are no prime numbers between 8 and 10. Similarly, you can prove (by contradition) that “There is no God that has destroyed the planet Earth that we call our home in such a way that the Earth is no longer here.” The proof that this isn’t the case is that we are currently on the planet Earth.

              So, no, the burden of proof lies with the ATHEIST, not the theist, OR, at least, it lies with both equally. In popular discourse, the burden of proof ALWAYS lies with the person who makes the claim that is not one that is generally accepted. Certainly, arguing that the tooth fairy exists or Elvis is still alive requires that the person asserting that position has the burden of evidence since it is commonly believed not to be the case. However, if you assert that President Obama does not exist, you would have the burden of evidence. That this is the position that has always been taken with regard to science is absolute fact. The notion that the sun did not revolve around the Earth was a negative claim that REQUIRED evidence to overturn the existing belief that it did. The burden of proof was not on the Church. Similarly, the burden of proof is on Darwin for evolution, not on creationists. It is only now that Darwin is considered generally accepted and that the heliocentric solar system is generally accepted that the burden has shifted to those who hold to creationism or to gencentrism. The proof always lies with the person making the unpopular claim. That would be you atheists, not us theists.

              Peace Be Upon You.

            202. God either exists or he doesn’t. He cannot both exist and not exist in the same way at the same time. This is a binary proposition. You believe God exists (in a non-physical form). I am calling bullshit. I demand evidence to support the claim. You then claim that you aren’t making a claim. Well then, if you are not claiming that God exists, then there is no issue. But the fact is that you are are claiming that God exists. You are claiming that God created the universe. This is a claim about reality. I am asking you to produce evidence for that claim. Without evidence to support that claim, there is no reason to believe the claim. We must assume that the claim is false until evidence suggests that is is true otherwise, we would have to accept that all claims regardless of their lack of evidence must be true. Odin must be true, the invisible pink unicorn must be true, and claim that Elvis is still alive must be true.

              God either exists or he doesn’t. I am arguing that unless you can provide evidence for your claim, then no one should take your claim seriously. You are claiming that there can’t be any evidence for your claim so therefore your claim isn’t a claim. But it is a claim and the fact that there can’t be evidence for your claim only supports the view that your claim shouldn’t be believed.

              You can argue that the word “claim” doesn’t mean “claim” or that “reality” doesn’t mean “reality” or whatever, but these are just verbal gymnastics that have nothing to do with the argument. They are just an attempt to hide behind grammar errors.

              Wittgenstein once said that all of philosophy amounts to grammar errors and that we are really just trying to get the fly out of the bottle. He may have a point in relation to our argument. My point is that you believe that God exists in some form somewhere in some kind of reality (even if it isn’t our universe but rather outside our universe). This is a claim about the state of affairs of reality. You are not claiming that that God only exists for you or that he only created your universe and not mine. You are claiming that a deity created the universe that we all share. This is therefore not a claim subjective to you (like tastes). Can this claim be objectively proven? that doesn’t really matter. We aren’t talking about proving anything here. Whether we can prove something is the case doesn’t change whether something is actually the case. However, if we cannot provide evidence for why we believe something is the case, then there is no reason to believe that it actually is the case (even if it actually is the case). There are two factors here. 1. is something actually the case and 2. can we or do we have reason to believe that something is the case. We cannot really know if 1. is true or false. All we can know is 2. We use the scientific method to figure out 2. because it is the best and only valid tool for accurately discovering 1. Our hope is that 2. will match 1.

            203. 1) Since you seem to not understand what a subjective claim is, here is the definition of a subjective claim so that you can understand:

              “subjective claims cannot be proved true or false by any generally accepted criteria. Subjective claims often express opinions, preferences, values, feelings, and judgments. Even though they may involve facts, they do not make factual (provable) claims, and therefore they are, in a sense, neither true nor false in the same way an objective claim is true or false. They are outside the realm of what is verifiable.”

              http://www.butte.edu/departments/cas/tipsheets/thinking/claims.html

              Subjective claims include metaphysical claims, valuative claims, and opinions. They cannot be proven and therefore there is no burden of proof placed on the holder of such a claim until he or she states that the other person ought to adopt it.

              Since God cannot be proven true or false by any generally accepted criteria, the claiming that God exists is a subjective claim.

              2) In any case, the rest of your argument is nonsensical. Either we are dealing with things that are demonstrably false (Elvis died–there is a death certificate) or something that the creator of the argument ADMITTED to making up and thus should not be believed (Russell’s Teapot*) or it is something that we can easily demonstrate is false but choose not to do so (the Loch Ness Monster can be proven demonstrably false by draining the lake) or it is something that everyone who advances the idea admits is false (the Easter Bunny, the Tooth Fairy).

              God falls into NONE of those categories (neither does Odin who is supposed to exist in another dimension). For deities who are not in objective reality (Odin and God qualify on this count, Zeus does not), one is making a SUBJECTIVE claim, not an OBJECTIVE claim.
              There is no good reason for atheists (or non-believers) to believe an existence claim of a believer but there is ALSO no good reason for a believer to believe the non-existence claim of the atheist either. As I stated before, the requirement for proof in these cases lies with the person who is arguing that the OTHER PERSON ought to believe the claim (that is when it goes from a subjective claim to an objective claim, since they are not DEFINING it as provable by trying to get the other person to believe it).

              Therefore, theists who claim that atheists ought to become theists need to PROVE to atheists that they are correct. Similarly, atheists who claim (as you keep doing) that theists ought to become atheists need to PROVE to theists that they are correct. The burden of proof with respect to me on the question of God’s existence lies with YOU and NOT with me for that reason.

              Here is a good analogy that demonstrates the problem with your argument (and the example I am giving is even giving you the benefit of the doubt because while God CANNOT be proven, life on other planets absolutely CAN be proven):

              Scientists generally believe that there is intelligent life on other planets and many believe that the life on those planets is actually more advanced than our own. Why? There is ABSOLUTELY NO EVIDENCE OF THIS. They just have faith that life exists on other planets and yet despite the fact that determining if there is life on other planets is something that is verifiable (though difficult to verify), we STILL have no evidence for it. I submit that NO ONE should believe that life exists on other planets using EXACTLY the same logic as you use. Furthermore, what is funny is that scientists generally dismiss all claims of UFOs and extraterrestrial encounters. Isn’t that odd? I mean if there is extraterrestrial life, why would it be so unusual that they might come here, especially if they are more advanced than us?

              Now, explain why it is reasonable to believe in intelligent life on other planets without ANY evidence (subjective or objective) but it is unreasonable to believe in God when there is vast subjective experiential evidence?

              *There is a ton of circumstantial evidence that the Invisible Pink Unicorn is similar to Russell’s Teapot and thus made up but since the creator of the IPU has not stood and claimed that it was made-up, I will give it the benefit of the doubt and place it in the same category as Odin and God. Thus the person advancing the claim by seeking to convince others that the IPU exists or that the IPU does not exist has the burden of responsibility, which is why I never deny the existence of the Invisible Pink Unicorn (please don’t kick me into the pile of manure, IPU!). In any case, Mariano Grinbank has a very good rationale to not believe in the IPU (and he has a similar good reason not to believe in FSM) but I don’t buy either argument since both rely on similar arguments that atheists can try to make against theists (which make such arguments immoral according to “Do Unto Others As You Would Have Done Unto You”). That is one good reason to be agnostic with respect to such deities.

            204. “subjective claims cannot be proved true or false by any generally accepted criteria. Subjective claims often express opinions, preferences, values, feelings, and judgments. Even though they may involve facts, they do not make factual (provable) claims, and therefore they are, in a sense, neither true nor false in the same way an objective claim is true or false. They are outside the realm of what is verifiable.”

              This definition is correct, but your interpretation of it is incorrect. Subjective claims are subjective to the person making the claims. Whether a deity exists is not subjective to a person. It is not a mere personal preference, a value, a feeling, or a judgment. It is a claim about the world. This is obvious and you are trying to play language games to avoid the meat of the issue. I have called you out on this multiple times now and you continue to play word games instead of actually addressing the real issue. The real issue is that there is no valid evidence that any deity exists and as such, there is no valid reason to assume one does. As a result, the only logical position is to lack belief until such evidence can be presented. If it is a metaphysical claim outside the realm of scientific inquiry, then there is no reason to accept it. Whether the claim is falsifiable is irrelevant.

              As far as life on other planets goes, there is evidence in support of this claim. For one thing, we found fossels of alien bacteria (i.e. life). Second, there is statistical reason to believe that life exists somewhere in the universe. The real question isn’t whether alien life exists in the universe, but whether or not that life is intelligent. Statistically, the odds are that there probably is intelligent alien life in the universe, but this is by no means certain. The evidence is there, but isn’t sufficient to make a solid claim. Again, it isn’t about proof, it is about the strength of the evidence.

              “why would it be so unusual that they might come here, especially if they are more advanced than us?” Because of the vast distances of space and the limit of speed. To our knowledge, it is not possible to go faster than the speed of light. We don’t even think we can go that fast. This would mean that it would take a ship from a nearby planet outside our solar system a long time to get here and we are quite frankly not that interesting to be worth that kind of trip. If there is a planet 100 light-years away, it could take an intelligent alien race several generations and that is if they are close by. Then you have to figure that for a long trip they would need supplies, fuel, etc.

              You have a profound misunderstanding of science and of logic. You distort definitions to fit your argument rather than use definitions correctly. You have made up your mind about the conclusion and are now trying to justify that conclusion instead of starting with the evidence and allowing that evidence to lead you to the conclusion. You are doing science backward and dogmatically holding to beliefs without thinking critically about them. You have admitted this. You have stated over and over again that you cannot be convinced that you are wrong. Then you project your arrogance on me. You talk about how you are afraid to even question your beliefs out of fear that Muslims will murder you, but then you blame me for merely trying to correct you when you say that 2+2=7. You keep claiming that you aren’t making a claim, but again this is just a word game. Either God exists or he doesn’t. He cannot both exist and not exist in the same way at the same time. You are talking about a binary proposition here and you are trying to hide behind some twisted view that God isn’t a think, but a matter of taste. But a someone subjectively liking an ice cream flavor has not impact on the state of affairs of the universe. It would be subjective to say that you like the character of Allah better than the character of Odin, but when you start talking about one or both of these characters as actual in some way (i.e. creating the universe and/or interfering in the universe) you are moving past a subjective claim of an objective claim. It is no longer merely a matter of taste.

            205. No, my interpretation is correct. You are using the example as opposed to the definition. In addition, you are overlooking the statement “often”. A subjective claim is not required to express an opinion, preference, value, feeling or judgment. In addition, you are forgetting about the third line, “Even though they may involve facts, they do not make factual (provable) claims, and therefore they are, in a sense, neither true nor false in the fame way that an objective claim is true or false. They are outside the realm of what is verifiable.”

              God is not verifiable by the construct that I have provided. Therefore, it is a subjective claim. The fact that you are deliberately misconstruing a definition that you have stated is correct means that your argument fails on its face.

              I make NO claim as to the existence of the deity. I have a belief that is all. It is YOU who keeps arguing that I am making such a claim but I have specifically renounced such a claim. If I DID make an existence claim, I would be putting forward the perspective that YOU OUGHT to believe it. I do no such thing. In fact, I state the contrary. Instead, YOU are making the objective claim that God does not exist when you state that I ought not believe in God or that I ought to believe in Odin if I believe in God. That is a lie and you know it.

              My claim did not deal with life (in general). My claim was Intelligent life. Indeed, even the evidence for alien life of a bacteria origin is scanty. There has been ONE claim that has not been verified:

              http://www.spiritscienceandmetaphysics.com/scientists-claim-to-have-found-proof-of-extraterrestrial-life/

              The problem with this claim is that the scientists have pointed out that a violent volcanic eruption could have caused this material to have gotten to the location in our atmosphere. Furthermore, that bacteria could have easily gone into space and then returned back to Earth. Extraordinary scientific claims demand extraordinary evidence and the evidence of intelligent life on other worlds is . . . zero.

              We have gone to Mars and there is ZERO evidence of intelligent life on that planet. Yet scientists now maintain (improbably from a scientific standpoint because it is based exclusively on FAITH) that the evidence must have been destroyed:

              http://www.openminds.tv/scientist-believes-evidence-alien-life-mars-destroyed/26012

              There is no evidence of intelligent life having been on the moon, although some scientists maintain that there is against all objective findings to the contrary:

              http://www.americanmonsters.com/site/2010/11/former-nasa-scientist-claims-theres-life-on-the-moon/

              There is STILL no valid evidence of extraterrestrial origins for any life form and there is CERTAINLY no evidence regarding the statement that I initially gave: intelligent life.

              By the way, if you are going to use a statistical argument: which is more statistically probable?

              An intelligent being created the universe in such a logical and ordered way setting it up so that humanity would eventually emerge on this third rock from the sun and be able to ponder these questions or the humanity evolved by pure chance on a planet that was created the same in a solar system created the same in a galaxy the same all in a universe was created by pure chance? Any rational individual would see that your creation “by chance” is an extraordinary claim that demands extraordinary proof. THAT is ALL the evidence a theist needs to believe I a creator and IT IS VALID EVIDENCE ACCORDING TO YOUR OWN ADMISSION.

              “You keep claiming that you aren’t making a claim, but again this is just a word game.”

              IF you insist that I am making a claim, then I can insist that you are making a claim that God does not exist. I can CERTAINLY demand you show proof of that claim to me. Your dogged determination to avoid this question is because you, like I, are NOT making a claim. You make no claim that God does not exist. You BELIEVE that God does not exist.

              You see, the problem is that we ALL must have belief. That is a NECESSARY condition for a claim but it is NOT sufficient. You cannot have “no belief” unless you have never asked the question. You believe that is no God. To say otherwise is intellectually dishonest. I maintain that this is not a claim just as I maintain that my professed belief in God is not a claim. I have ABUNDANT evidence that Allah is the creator of the universe. However, I have no OBJECTIVE evidence of that. The evidence I have is ALL that I need. You have made it clear that you do not accept the subjective evidence of others. Fine. You have, I am certain, subjective evidence that this claim is inaccurate. Fine again. Then don’t believe but don’t denigrate those of us who have religion for believing what we do, just as we shouldn’t denigrate you for believing what you believe. We were both know the truth come judgment day. If it occurs, you will be judged for your insolence. If it does not occur, you will be vindicated. Simple enough, isn’t it? Similarly, I will know on judgment day. If it occurs, I will be judged according to my faith. If I am inaccurate, I will be consigned to the fire. So what? I don’t care. If I am accurate, I earn paradise. If it does not occur, you will be vindicated but really, does it matter?

              The fact is that you cannot prove my claim or disprove my claim. That is why I am dismissive of any evidence. Since it is impossible to prove or disprove God, why should I listen to lies? Now, I HAVE made a claim of knowledge and that is that God’s existence cannot be known and I have proven that by defining God in such a way that His existence cannot be known. If you have a proof that God can be determined to exist that does not depend on God revealing Himself to you (but rather that can detect Him even though He desires NOT to be detected), THEN I will listen to you because THAT is the only objective claim that I make. Yet, it would seem that you agree with me, so why are you arguing? Let’s go beyond the semantics, okay. I submit that there is NO OBJECTIVE EVIDENCE THAT CAN BE OFFERED FOR GOD’S EXISTENCE. Got it? If you agree with me, then you MUST agree that I have offered a subjective claim regarding God as it is merely a statement of belief (go back and READ the definition of subjective claim again and show me where I am inaccurate — the answer is that you cannot because I am absolutely making a subjective statement, i.e., what part of “subjective claims cannot be proved true or false by any generally accepted criteria” That is the definition. Deal with it. While feelings, emotions, etc. can play a role, the definition of God CLEARLY is considered with this statement, “Even though they may involve facts, they do not make factual (provable) claims, and therefore they are, in a sense, neither true nor false in the same way an objective claim is true or false. They are outside the realm of what is verifiable.”

              You have been intellectually dishonest because you ignore the key word that modifies the sentence on which your argument hangs:

              “Subjective claims OFTEN express opinions, preferences, values, feelings, and judgments.”

              The mere FACT that the word “OFTEN” is present PROVES UNDENIABLY that you are intellectually dishonest in this regard. Now when you ADMIT that I am making a subjective claim, we can get back to a proper discussion on this. Otherwise, you have proven NOTHING and I have nothing else to prove.

            206. “So you are really an atheist and you have stated that you are afraid to question the beliefs you were indoctrinated into out of fear that Muslims will murder you… but it is all my fault that Muslims will murder you because… ”

              Again, a LIE. I am not an atheist. I believe in God. I am an AGNOSTIC theist. There is a difference. You keep moving people from the agnostic camp into the atheist camp. That is incredibly offensive.

              You also keep misrepresenting the argument and keep incorrectly using standard definitions because your case is so weak. That just isn’t intellectually honest. You insist that ice cream cannot be liked because it does not exist. I state that I like mint chocolate chip ice cream. From what I can tell, the only reason you state that ice cream does not exist is because you claim to have never seen ice cream before and yet when we all tell you that there is subjective proof of ice cream that ice cream exists because we like it, you refute it by saying that what we really like is gelato and every time anyone provides you proof of ice cream, you resort to your (inaccurate) definition, like when you state that anyone who believes in Spinoza’s God is an atheist, when Spinoza himself denies that:

              http://www.pantheism.net/paul/history/spinoza.htm

              Spinoza was a theist, a pantheist, mind you rather than a monotheist, but he was clearly a theist.

              So do you believe in Spinoza’s God or not? If you do, then you are a theist, by definition — a very weird theist from the perspective of monotheists, but still, a theist (specifically a pantheist) rather than an atheist.

            207. Atheist Morality is 100% subjective. It is no different from me saying Strawberry is the best flavor of Icecream and you saying Vanilla is the best… WHO IS RIGHT??? WHO IS WRONG??? which flavor is actually the best? You cant say what I am supposed to like best, and I cant say what you are supposed to like best…. so what about murder or rape or stealing? what if that is ok for me but not for you? why is what I believe wrong? If you dont have a God that created the universe and says what is right and wrong, then you can NEVER judge anyone ever again… throw out the courts… and just do what you want…

            208. 1st off – your facepalm comment is funny… keep hitting yourself, it might knock the foolish thinking out.
              2nd – I read your article and it is a joke. I stand by my statement, if you are just a blob of cells that evolved by random chance then you have no ground to stand on and say this is moral and this is not moral… everything is subjective.(and your life has no meaning in the end, so just go and do whatever you want and have fun, cause after its done, there is nothing else, give the worms some food)
              3rd – I can see that you are a militant atheist by your other posts here so unless you show some signs that you will humble yourself and say you are wrong and actually still teachable, I will most likely leave this conversation and spend my time elsewhere with someone who is actually humble and looking for the truth.
              4th – there is evidence everywhere of the existance of God, but you just look at it in a different light… and interpret it differently. You put your faith in science and believe that a singularity created you… I put my faith in God and believe He created me… neither of us were around to see the creation of the universe and the 1st life forms come alive, so we have to believe it happened a certain way. If you can admit that your belief is religious and based on faith just like mine, then I believe we might have a good start and can have a conversation like 2 grown adults.
              Thanks,
              Jonathan

            209. 1. You Christians often complain that atheists call them stupid. You’re not helping. 😉
              2. You are standing by a refuted statement? At least you’re not dogmatic or anything, lol.
              3. Not only do I not own a gun, I generally am against violence. So I really don’t see how I could be a militant atheist. You on the other hand support the eternal torture of pretty much anyone who don’t believe in your deity of choice. That’s a little bit militant.
              3.5 Then you want to talk about being humble? I have admitted multiple times that I am open to changing my position on anything. All it takes is for someone to present some valid evidence and I’ll change my position. I have changed it before and I am willing to change it again. You on the other hand hold absolute certainty in your beliefs. And what are those beliefs? You believe that God created you special and that he created this entire universe just for us. How egocentric is that?
              4. No, there are naked assertions everywhere for the existence of God, but no actual testable evidence. As for the Big Bang, there is actually a lot of evidence supporting it. Just a few weeks ago, we discovered gravitational waves that allow us to see less than a second after the Big Bang. You claim that neither of us were there, but the fact is that isn’t really true. We have an awesome time machine that allows us to see back less than a second after the Big Bang. I’m sure I don’t have to explain the speed of light to you since you are no doubt a smart person, but when you look up at the sun, you are actually seeing it has it looked 8 minutes ago. Space is the ultimate time machine. It takes 8 minutes for the light from the sun to reach our eyes. So yes, thanks to gravity waves we can now see less than a second after the big bang. No faith required.

            210. Your assertion is in fact a faith statement. You do not know your statement to be True.
              You have faith that it is true.
              But the vast majority of the “Facts” Atheists believe in, is based on faith that they are indeed Facts.

            211. “Yes, atheists base everything on facts not faith.” Not really. You cannot prove that it was not god(s) that made the universe, you cannot prove they are not outside of the observable universe or have any control over it. The only religious view based on facts is deism, as agnostics claim they do not know.

            212. No, we can’t prove God does not exist and that is why we don’t believe that he does. I am an agnostic atheist. I lack knowledge, therefore I lack belief. If you believe it is true, then provide some evidence behind your belief.

            213. And of course, you have read the Bible several times, understood it and prefer you life without faith.

              Assuming you never practice any faith, then of course, you don;t believe.

              Or having asked for something of things, you just gave up.

              I honestly feel sorry you.

            214. Here you are spouting ignorance. You have no idea my background and yet all you would have to do is look at the “about” page and find out. That’s willful ignorance. I feel sorry for you because you seem to enjoy being ignorant and not knowing things that you could know if you just took the time to look it up.

            215. What facts do you have concerning the creation of our universe?

              Do you even know what universe means?

            216. Haha. Man, aren’t you an idiot. The guy you responded to used quotation marks in order to highlight that YOU consider them to be facts, but they are not. It’s hilarious when morons like you act all haughty and more intellectual than those you disagree with – when you’re obviously less intelligent. — And hey wow!! You’ve written lots of articles!! WOO-HOO!! You must be really somethin’, eh??? Fricken’ KNUCKLEHEAD.

            217. Daniel 12;4-But you, Daniel, keep this prophecy a secret; seal up the book until the time of the end, when many will rush here and there, and knowledge will increase.

              “Buckminster Fuller created the “Knowledge Doubling Curve”; he noticed that until 1900 human knowledge doubled approximately every century. By the end of World War II knowledge was doubling every 25 years. Today things are not as simple as different types of knowledge have different rates of growth. For example, nanotechnology knowledge is doubling every two years and clinical knowledge every 18 months. But on average human knowledge is doubling every 13 months. According to IBM, the build out of the “internet of things” will lead to the doubling of knowledge every 12 hours.

              We can now travel any where in the world in hours not days, we have only had this ability for less than 100 years.

              How can something written thousands of years ago, come true in our time? I have asked this question many times and no one can explain it. Just a fact that you can ponder.

            218. Sorry, but religion isn’t the cause of all death and suffering. Communist regimes killed more that 150 million people in the twentieth century. That’s more than the world wars, plague, the Caliphate, the Inquisitions and Crusades, combined. You know, those Communist regimes who say there is no God? Unless, of course, you would like to admit
              Atheism (along with evolution–questionable because of the lack of evidence in the fossil record, and the many exceptions in dating results when there shouldn’t be any) is faith-based.

            219. Christians have both faith and facts. “Without faith it is impossible to please God.” And you WILL bow the knee to Him at the last day.

              I wish I had a dollar for every time I’ve heard atheists say, “I don’t believe in anything I can’t see or touch.” Well, stop breathing then, because you can’t see air, nor can you see or touch many things you take advantage of each and every day.

            220. Most atheists have “faith” in the human race, which sure sounds better then believing in an imaginary, immortal deity which demands people to “pray” to him in order to get good luck and salvation, and the people who don’t get swept away to an eternal torture chamber.

            221. having faith in yourself is not a bad thing. hoping or depending on something or somebody else to make your life better is taking accountability out of the equation. YOU have the power to make YOUR life amazing. the idea that you are taking this disclaimer, about an obvious shaddy advertisement that is wasting the time of dying people, and inserting your opinions about atheism is sad.

            222. We do not. We do not think we are all powerful. We simply live in the actual reality. Its you idiots who need the crutch of a magic friend.

            223. Your argument is always going to be counter productive because all you do is point to a moral set of standards used by religion as a guide to mans preferred behavioral patterns. Religion that you point to, was as a matter of fact determined by a set of scribes written by men, dictated by men, authored for a King, or sets of kings as scribes under original Jewish law. The new covenant as passed to Jesus, has no factual evidence that is why a Religious person must have faith in the word. An atheist as such as you rightly point out has replaced Christian faith in God with faith in themselves, but this is not really where you want to go with this… because if you compare Gods laws, and Gods new Covenant with man, and then compare how most men choose to live themselves, you will find that they are remarkably similar. Even though they are are not the same, would you suggest that men are close to the divinity of the Christ and God, all by themselves ? It seems that normal people under your own axiom are more God like than God himself.

          3. let’s say you are correct and hail is imaginary. You have lived your life by your own rules with nobody to answer to.some day you die and are buried never to live again. Now let’s say that you are still correct and I have lived a Christian life. I have live by rules in the Bible that tell me to love everyone and a treat everyone with respect and be an all around good person. I die leaving a good memory behind and then buried never to be alive again. Now let’s say that I am correct believing in Christ and in Hell. If you live in a more alive do I need you please with no one to answer to you die and going to a devil sale where the worm will never die and you are in torment forever. As a Christian I have accepted crafts ways of life and believe and following him. When I die I know where I will be in heaven with the rest of Christ followers no more pain no more worries no more tears. Right a wrong the teachings of Christ has made me a better person.

            1. Wow, a strawman and Pascal’s Wager in a single comment. Impressive. Let me try. Let’s say you are correct and I live my life according to secular humanism. I treat everyone around me with compassion and dignity and strive to make the world a better place… but when I die, your deity has judged that because I didn’t believe in existed on insufficient evidence, I should be tortured for all eternity.
              On the other hand, you lived a life according to the Bible in which you stoned adulterers, gays, blasphemers, and non-believers and then sold your daughters into slavery. God has granted you eternity in Heaven.

              I think I would rather burn in Hell for all eternity as a good and compassionate person than live eternity in Heaven as a slave to an immoral deity.

            2. Well, that is the most asinine comment I have ever heard. I seriously don’t understand your thought pattern.

            3. When the adulterous woman was about to be stoned to death, Christ intervened and said: “Let he who is without sin cast the first stone” If you remember what you said, D.T. when you’re in Hell, you’ll be kicking yourself. I believe Hell is a lot worse than you or I can imagine. Besides, you don’t work your way into Heaven, it is a gift freely given to those who truly believe. The “good works” come from gratitude to Christ for ones salvation. I just wanted you to have the Gospel presented to you in an accurate way, that way when you reject it, you will do so having been offered the truth. Until your last breath, there’s always a chance, but God won’t force himself on you.

            4. I have had many conversations with people of various religions and various different types of Christians. I have read the Bible cover-to-cover at least twice and used to regularly attend Christian meetings and Bible study. It is safe to say that I have been presented with the Gospel.

              Second, that story about the adulterous woman was added to the Gospel hundreds of years later. It was edited it later. Any reputable Bible Scholar will affirm that. That is seminary stuff.

              Threats of eternal torture don’t make me more likely to believe, they make me less likely to believe. Even if you could present valid evidence that your deity were true, such a threat makes me less likely to worship him and it should make you less likely to worship him too. Torturing people is wrong. It is wrong to torture people for five minutes and it is wrong to torture people for all eternity. Any all-powerful deity who allows it is not an all-powerful deity worth the worship. Think about it.

            5. Seminary stuff? Apparently the Seminary trained pastors I’ve had with doctorate degrees must have missed that class. I too have read the Bible through, but considerably more times than twice. Your feeling of not wanting to worship what you see as a vindictive god is your feelings. I’ve no desire to argue about that, just your statement about story of the woman caught in adultery. This is your page which I didn’t realize at first, so I’ll drop my discussion with you. Have a nice life, D.T.

            6. Yes, Seminary stuff. “Two of the most important interpolations are the last verses of the Gospel of Mark[98][99][100] and the story of the adulterous woman in the Gospel of John.[101][102][103]” – http://en.wikipedia.org/wiki/Historical_reliability_of_the_Gospels#John

              Second, I have read parts of the Bible multiple times. I said that I have read it cover-to-cover at least twice. Most people don’t read the Bible cover-to-cover. I would be very much surprised if you did. It really is a boring book and it is pretty hard to get through cover-to-cover. Most people just skip around and read the parts their religious leaders tell them to read.

              Again, torture is immoral. It is immoral for 5 minutes and it is immoral for all eternity. Do you really “feel” that torture is morally good? Is that what your sense of morality tells you? Would you torture someone? Would you torture little children and babies? Would you worship someone who does?

            7. Yes I have read the Bible “cover to cover ” The Old Testament three times and the New Testament about 15 times. There are no such verses as 101.102,103 , Mark has 16 chapters an the 16th chapter has 20 verses. Likewise with the Gospel of John. You don’t help your case with that kind of reference. If you think the Bible is boring, you should read the Koran. I havei only to understand somewhat the way Muslims behave. I don’t have a clue which verse you’re referring to , since you must have pulled them out of another source than the Bible. At any rate if you’re pointing out discrepancies in those two gospels, it is because they were observations by two different people. Just like different witnesses to an event will have somewhat different observations. I don’t mind you having the last word but arguing the Bible with me is just a waste of your time and mine. You don’t believe and I do. You cannot prove that God doesn’t exist, just as I cannot prove He does. Why is it so important to you to belittle others who do believe. Other atheists I know don’t have to justify their beliefs by cutting down believers.

            8. *double facepalm* The references were from the Wiki article I sourced with a link. Check out the link and then check out the wiki sources. Wiki is just general information and the sources are what is important. My point here is that the chapters in John dealing with that parable are well known to have been added much later. Like I said before this is seminary stuff.

              You are admitting that you are a closed-minded person. I don’t actually believe you are as closed-minded as you are claiming to be. I think you, like everyone else, are open to the evidence if you are exposed to it. I am trying to get you to question what you have been told. You have to do the work though. I can only point you in the right direction. If you have any kind of curiosity, you will start looking into these things. Chuck, you have been lied to and swindled and I am trying to help you. Don’t take my word for anything. Research this stuff on your own.

              I don’t have to prove God doesn’t exist. I just have to point out that the Bible is not a valid source and that it has been edited by people with differing agendas over a period of time for various political reasons. Christianity is a scam and it has stolen much of your one and only life away from you.

              Finally, I have never belittled anyone no matter what religion they are. I take issue with your claim. I criticize ridicule religious beliefs, but never ever, do I belittle religious believers. On the other hand, Christians often wage personal attacks against me. I consider your accusation that I belittle people as just that. So I have to call you out in this. Please provide an example of me belittling people. I have written hundreds of articles and blogs and I bet you cannot find a single example of where I have done anything like that. I take great offense to being accused in this way.

            9. D.T., you’ve been listening to yourself so long that you can’t hear what you’re saying. Example of belittling others? Just about any of your comments above and below this one would qualify. I read your references in Wikipedia, so as to address it. The term used in one sentence relating the story to interpolations of other parts. Pretty weak. I didn’t approach Christianity or the Bible from a desire for knowledge in my younger years, being skeptical. Events happened that piqued my interest(I call them miracles, but I’m sure you have another word for it) I first became a theist about 25 years ago and 20 years ago I accepted the Lord as my personal Savior.
              You sound sincere about my wasting my time and if you are, thank you. Using your logic, I claim that Wikipedia is not a reliable source since they are in the business of revisionism. What say we agree to disagree and leave it at that.

            10. So let me get this straight. You insult me by insinuating that I just like to listen to myself and then accuse me of belittling others. I ask you for a specific example in which I belittled a single person and all you can say, is “everything.” Be specific. Give me one example because I really don’t think you can find a single example of me belittling anyone. While I admit that I am critical of beliefs and often belittle ridiculous beliefs; mocking beliefs is very different from mocking people (which is what you have accused me of). If seems to me that Christians have no problem mocking people and then are quick to falsely accuse others of doing just that.

              Wikipedia is a good general knowledge source, but is not a good source in and of itself. It cites other sources most of which are generally reliable. That particular part that I referenced had many sources and I have also heard similar things from seminary students and professors. The part that I referenced had a good overview of the claim plus sources which is why I cited it. I claimed that this is seminary stuff and that is exactly what it was. As I said before, seminary Christian scholars do not think that the parable was part of the original text. It was probably added hundreds of years later. You can’t dispute this with facts, so you attempt to go after the source and to personally attack me for citing it. Sorry, but that isn’t how academic discourse is done. If you have evidence, present it. I advise you to do your own research here. Don’t take my word for it. Look into it on your own. Google is your friend. E-mail Yale seminary professors and professors at other seminaries. We live in a time where you can really learn this stuff on your own if you really want to find the truth. But you don’t really want the truth, do you? You just want to spout out a bunch of nonsense and then attack people for calling you out on it. That’s a shame.

            11. I wasn’t insulting you, I was correcting
              you. Like I’ve said twice before let’s agree to disagree. Follow this up with some more of your wisdom, but I’m done. Like I said before, have a nice life and if you’d like to tell yourself you won an argument with, be my guest.

            12. I would be happy to let it go when you admit that you lied when you claimed that I belittled people when I did not. That shit isn’t going to fly with me. You can’t just make an accusation against someone without evidence and then turn around and run away.

              I will defend my reputation against your false accusations and I do expect an apology from you for making false accusations.

            13. I can call you a LIAR, because you TRIED to belittle me by referring to me as being dumb!

            14. You treated me as being dumb first, so I take the “in kind” exception. If someone insults me, I may or may not insult back. But I don’t start insulting people. I don’t call people stupid or dumb. I don’t treat people as being stupid or dumb… unless insulted in that way first. Even then, I usually don’t do it. But you pulled it out of me. If you don’t want to be insulted, then treat people with respect, don’t belittle them or yell at them.

            15. Let me get this straight I was (at least that was my thought) showing you what I thought were your words, and was corrected & thusly apologized for my error. And because I was bringing to the for front what I thought you said, so that YOU wouldn’t make an error in your quoting that you took it as an INSULT? I’m sorry sir but at that point I didn’t know you well enough to insult you. But I do now!
              Not a problem. I see how this works. YOU are an idividual of little self restraint as am I. Like YOU I’m liable to tell you to kiss my A.. and not think twice about it. Because YOUR opinion about me won’t affect me in the least. YOU or NOTHING YOU DO has any significance in my life, none zilch nada! If I don’t ever speak, type or piss on your name again in life, it won’t affect Jack-Shit in my life. Just like I don’t matter to you,YOU have NO SIGNIFICANCE TO ME!!!
              Oh and have a nice day :-) See how easy that was!

            16. First off I really feel sorry for you reading the Bible cover to cover. That is not how it should be read, nor was it written cover to cover. There was not 1 author for the entire book but over 60 authors and over the course of centuries, not days, weeks, months or years.
              It interests me that you assume that there is no proof of God’s existence. Do you believe in the boogyman? Me either, it/he is obviously a fictitious character. However, science knew NOTHING about oxygen, CO2, Nitrogen, etc. inside of the air we all breathe each day at one point. Heck, if I were alive back then, like 2000 years ago, and I said that the air was made up of thousands of different microscopic vapors I would be stoned at the spot! Science is the only subject in any form of education that accepts an answer for being correct 100% of the time when in truth it is only right the vast majority of the time.
              One day, I was driving down some very small back roads almost a year ago easily going 70-80 in the middle of a rain storm in which I remember the weather forecasters announced we had gotten 3-4 inches depending on the county. I knew the road I was on had flooded spots but I did not care. I was at one of the lowest spots I have ever been at on that day. I stopped my car at a stop sign and screamed. I demanded God show His “Lazy ass face and let me know He was there. I know You are there, I need you here. I cannot do this alone God. I need You.”
              The rain stopped almost immediately and the clouds parted right outside of my drivers side window. I sat there at that spot for 10-15 minutes amazed by what I was seeing. I thanked God for listening to me and I just smiled. I apologized to Him for the weakness in my faith and swore to never let it go again. I turned back to the road in front of me and the rain picked back up immediately. The sky again was dark grey all around and it was like that moment never happened.
              For all of the atheists on here thinking that I was under a tree, HA. It was on Co. Rd. U. and 10. (Henry County Ohio) Go check it out for yourself. The only thing at that crossing aside from the stopsign is a telephone pole or two and the wires. The closest tree is in the house back from the corner about 200 feet, the tree being maybe 20 feet in front of that.
              If you do not believe in something, you will not see it. I can be a doctor and tell you that you have cancer and at first you will tell me I am crazy, stupid, whatever. You do not want to see God because that would mean that some things are out of your control, out of ANYTHING’s control but His.

            17. Is torture always immoral? If you have a terrorist who can give you the location of a nuclear bomb that is set to go off in an hour, would you stop to think about not torturing them?

              More to the point, the issue of torture by God is part and parcel of our conception of Him in anthropomorphological terms and a belief that we are somehow the creator’s equal. Similarly, our conception of morality is grounded in our own man-centered beliefs. I will give you a clear example. We rightly describe the experiments that the Nazis and Japanese did on their captives as torture even if they had a byproduct from that research that might end up assisting others. If I were to go around deliberately infecting individuals with ebola or cancer to test a vaccine you would rightly declare it to be torture. Yet we routinely do such things to lab mice despite the fact (or more accurately because of the fact) that lab mice differ in genome by only 2.5% from humans. Surely we are closer in this regard to mice than we are to God, so who are we to judge the judge of all our activity?

              Except for those who take the ascetic position of the most strident of Buddhists, we are all hypocritical on this point.

            18. When it comes to gathering information, it has been routinely shown that torture doesn’t work. The information torture yields is almost always inaccurate. It looks great in the movies and on television, but in the real world, torture just doesn’t work.

              When it comes to scientific knowledge, your analogy suggests that God doesn’t know how the universe works and therefore needs to torture humans in Hell in order to learn some fact about reality that he doesn’t know. I thought God was supposed to be all-knowing. So this analogy doesn’t really hold in this case. So the question remains, is torturing people for all eternity for the finite transgression of not believing something on insufficient evidence moral?

            19. You are not responding correctly to the points made.

              1) I am pointing out that there may be reasons why torture is acceptable. Just because it does not work routinely does not mean that we would universally condemn it. In the case cited, if there was a nuclear bomb in your city set to go off in an hour, I think that you would employ torture regardless if the chance of success were miniscule or not. The point is that things are rarely absolute.

              2) The second point is that the notion of torture is based on our anthropomorphological beliefs in God. We simply do not know what happens after we die and scriptural evidence suggests that what is “torture” is simply eternal separation from God or a mechanism by which you simply no longer exist (which people who believe in God think is true), not torture in the sense that we think of it. Torture is, in fact, is basically a device to “scare the believer straight.” If you do not believe in God, you have nothing to fear from it. If you believe, it would be torture, not unlike having your parents not allow you to visit even though you now have great contrition for past wrongs.

              3) The final point, related to the second, is that your notion that there is no God is fine with you. You have made peace with that. I have made peace with the notion that God will judge me and I am absolutely okay with anything that the creator decides. It is not for me to judge what the creator will do. If I am eternally separated from Him, that WOULD be torture from my perspective as surely as anything else is. Therefore, from my personal perspective, if you were to disprove God (which you cannot because whether God exists is purely opinion anyway), you would be the most evil, reprehensible, and callous individual on the planet. You see, in order for there to be justice from the victim’s perspective, if I were the victim of a holocaust such that the Nazis perpetrated, I would ABSOLUTELY need to believe that those who perpetrated crimes against humanity ARE tortured eternally. I am sorry but without Hitler dying a billion deaths there is no justice. If good does not ultimately triumph over evil, there is no justice. If right is not always superior to wrong, there is no justice. Without a final independent arbitrator of whatever you want to call it (God, karma, etc.), the world ceases to have meaning and there is no reason not to behave in a callous manner towards others. This is why we have laws, of course, but if the lawgivers are corrupt, how can we guaranteel the lawgivers answer for their crimes?

            20. 1. No, studies have shown that torture does not work. It is not effective. It does not provide reliable intel. If someone planted a nuke in the city set to explode in an hour, you don’t torture them; you bribe them.

              2. As it is with all things, it is the thought that counts. I don’t believe in Heaven or Hell, but when someone threatens me with Hell, they are telling me that I deserve to be tortured for all eternity. That isn’t a very nice thing to say even if I don’t believe it is true. It’s the thought that counts.

              2.5 The Bible is pretty clear that Hell is not a good place. Jesus said that it is better to pluck out your eye and cut off your hand rather than spend eternity in Hell.

              3. According to Christianity, because Hitler was a Christian and the Jews weren’t, Hitler will spend all eternity in Heaven (his sins forgiven through the blood of Christ) while the Jews he threw in the ovens will burn for all eternity in Hell because they did not accept Jesus as their Lord and Savior. That’s justice?

              No, there is no universal justice. We do good things because they are good in and of themselves. Acting morally has positive results. It makes us happier and it helps others too. Religion has skewed your view of morality, my friend. Punishment is not justice. We don’t punish forces of nature, but simply protect people from them. The job of prison is ideally to 1. protect people from those who act immorally and 2. reform those who act immorally so that they can change and act morally.

            21. 1. You are wrong. Although torture is inconsistent in its ability to provide reasonable intel, it has also worked at times (see, for example, the Daschner case, although I believe torture was not justified in that case) and there is a compelling morale rationale in the limited case of the so-called “ticking time bomb” scenario (which I believe to be most certainly justified). See the Stanford Encyclopedia of Philosophy entry on torture: http://plato.stanford.edu/entries/torture/

              As to your idea of bribing the terrorist, I find that laughable. You don’t reward terrorism since all it will do is encourage more terrorism.

              Furthermore, the only type of “bribe” that a terrorist would accept would be something that would end up resulting in even more deaths than the nuclear device. Remember, I used the case of a terrorist, as opposed to someone who is in it for the money.

              In addition, what is not normally discussed is that the single biggest reason for torturing in a “ticking time bomb” situation has less to do with finding actionable intel (though it is really the only way you can get such intel under such circumstances) and much more to do with being a deterrent to future terrorist actions.

              2. You are again wrong in your assumption. Neither I nor anyone else can “threaten” you with hellfire. Indeed, it would presumptuous of me to make such a claim. As I have pointed out, I am an agnostic theist when it comes to God, therefore, from my perspective, my issue is with anyone who claims knowledge of the hereafter, whether they be a believer or an atheist. However, your atheism is not a threat to me nor is a Christian’s belief that I am going to be damned in hellfire. If God does not exist, there is no way I am going to hell. Indeed, if hell does not exist (even if God exists), I am not going to hell. If hell does exist, however, I don’t want to go there. The only way that you can view something as a threat is if you believe it to be credible. I view the threat of hell as a credible threat and therefore take actions to avoid it. If you do not view hell as a credible threat, it is not a threat to you.

              3. Please note. I am not a Christian. Therefore point 3 is non-responsive. If there is a Hell of the fire and brimstone/endless torture variety (and I believe that there is, though I think that very few people actually go there — the vast majority will either be zapped into nonexistence or be received in heaven eventually), Hitler is going to Hell. No two ways about it. That isn’t a threat for Hitler because he apparently didn’t believe he was going but I take comfort in the belief that he is burning for all eternity. As for you I see no reason to see why you should go to Hell and don’t believe that you will. I don’t think that God punishes you for mere belief. Indeed, my religion says that you are not punished provided you never were Muslim in the first place. I do believe God will punish me if I choose to disbelieve. Therefore, it would be an immoral and evil act for you to try to convince me otherwise not because it will affect your eternal soul (since you are free not to believe in God since you are not a Muslim and never have been one) but rather because it will affect mine. To a Muslim an individual who is true to their own selves and follows a moral pathway may be saved. However, understand that unlike Christians, none of us are guaranteed salvation. There is no get out of Hell free card. You have to do good works (technically there is one other way to earn heaven and that was to die as a jihadist during the time of Muhammad or the Rightfully Guided Caliphs but that door closed in 661 AD and is therefore no longer open).

              As to your notion that we do good things because they are good in and of themselves that is wrong. We do things to advance our own interests and others are served similarly (see The Wealth of Nations by Adam Smith for a good exposition), although it is certainly true that people tend to advance their interests when they do good (see The Theory of Moral Sentiments by the same author). Remember, however, that sometimes doing the moral thing can harm a lot of people as well. You simply do not know what the consequences will be. As they say, the road to hell is paved with good intentions. I am sure that you would agree with me that it would have been immoral to kill Hitler as a baby (since you could not foresee that he would turn into a monster) but it is almost a certitude that the world would have been a good deal better for it (there is the possibility that someone he killed would have been worse — but I doubt it).

              Finally, you do not understand the complete purpose of prison. While the first two are certainly true, they are minor in comparison to the third (and actually most important) component: to act as a deterrent for others who seek to us harm. The mere threat of punishment does deter a very great many people from doing wrong. The fact that criminality increases when the ability to do so undetected increases is proof positive of this point.

              Peace Be Upon You.

            22. 1. Sorry no. We didn’t capture Bin Laden through torturing terrorists. We got his location from bribing terrorists. This is a fact. The FBI rejects the use of torture and has stated and issued multiple reports detailing why torture doesn’t work. The CIA water boarded one suspected terrorist almost 100 times and never got anything worth wild out of him. Torture doesn’t work! Eternial torture certainly doesn’t work since there is no possibility for parole or repreive. Again, torture is not moral. No one should ever be tortured – not for five minutes and certainly not for all eternity.

              2. Again, I don’t believe in Hell or God so it is not a threat that I am worried about. However, the person asserting that I am going to hell is indeed making a threat. I may not believe that threat is real, but they are still making a threat… and as it is with all things, it is the thought that counts.

              Plus, some religious believers aren’t content to just let God sort it out. They feel the need to defend their all-powerful deity’s honor and so they may actually act on their threat in an attempt to “send me to Hell.”

              3. Hitler may be burning in your Hell, but he is safe in Christian Heaven. Fortunately, I don’t think he is there either. I am reasonably sure that when you die, you are dead. I know that sounds crazy and all, but we are not Super Mario. We don’t get extra guys.

              I am glad that you don’t think I deserve to be tortured for all eternity, but Most religious believers do believe with absolute certainty that I do in fact deserve eternal torture and that I will be going there. The fact is that no one deserves that. Not even Hitler. Don’t get me wrong, Hitler was a really bad guy for 56 years of his life. But how can you punish someone for 500 years because of stuff they did in the first 56 years. How can you punish someone for 5000 years for stuff they did in the first 56? How can you punish someone for 5 million years for stuff they did in the first 56 years? How about a billion years? Or a trillion years? Eternity is actually a pretty long time.

              ” I do believe God will punish me if I choose to disbelieve. Therefore, it would be an immoral and evil act for you to try to convince me otherwise not because it will affect your eternal soul (since you are free not to believe in God since you are not a Muslim and never have been one) but rather because it will affect mine.”

              Again, it isn’t immoral for me to convince you that your beliefs are wrong because you won’t be going to Hell if you leave Islam. Why? Because Hell doesn’t exist!!! Think for a moment about what you are saying here. You are saying that is someone has convincing reasons that you are mistaken about something, it would be immoral for them to share those reasons with you. Look, if I am wrong and Allah is the one true God, please convince me!!! I want to know because I am a curious person and if I am wrong, I would like to change my position so that I am right. You are saying that even if you are wrong, it is immoral for anyone to point that out to you because you believe you will be eternally tortured if you change you position. That doens’t seem very open minded or rational to me. Maybe I am showing my bias here, but I think people (myself included) should always strive for the truth no matter what that truth might be. We should change our position based on the evidence and not refuse to change our position out of fear of imagined consquences.

              4. Human beings do things out of our self-interest. That is true, but not everything we do is out of our self-interest in the way that Adam Smith claimed. That isn’t to say that we sometimes do things that aren’t in our self-interest. I don’t think there is true altuism in that sense but we do derive happiness from making other people happy. Altuism feeds our self-interest. Aristotle pointed out that happiness is the real goal of life. Which means that helping others even if it means giving up something we value better furthers our own self-interest. Adam Smith didn’t see that coming.

              5. Kant talks about principles and how that plays into our morality. I think he was on to something there. Killing baby Hitler would be wrong. I think the John Sheridan approach would be better. You might not be familiar with that reference, but the was a Babylon 5 movie called “The Lost Tales” that deal with this very question. To solution isn’t to kill baby Hitler; it is to educate Hitler to be different. That takes time and a life long investment into young Hitler’s life, but if you know he will grow up to be Hitler, it might be worth dedicating your life to teaching him to be different. Destiny doesn’t exist. Baby Hitler isn’t destined to be ruthless tyrant Hitler. Free will is an illusion. We are all a product of our nature and our nurture. If we have the opportunity to kill baby Hitler, we have to opportunity to nurture baby Hitler too.

              You are correct that we can’t really know the consequences of our actions, but we can have a reasonable expectation of what those consequences might be and we should act on those expectionation.

              Prison isn’t a deterent because most criminals don’t believe they will get caught. Studies have shown this to be true. Prison is a really poor deterent. That isn’t to say that absolutely no one is ever deterred, but that most criminals are not deterred. A better deterent would be to make sure that potential criminals have no desire to be criminals. This means that we have to improve the quality of life for everyone. Studies have also shown that crime goes up when the economy goes down and crime goes up in areas where poverty is highest. Again, it isn’t about free will, it is about nurturing better behavior. This is just another example of how religious thinking harms society.

              In reason,

              -Staks

            23. 1. I never claimed we captured Bin Ladin due to torture. You have not proven anything. You are taking a moral absolutist claim that torture is always and everywhere immoral and yet you have proven nothing. I have stated that in the limited case of the ticking time bomb, torture may be considered moral (note that I still did not actually go so far as to state that it was moral in the sense that actual circumstances would dictate that we should torture).

              Furthermore, you cannot impose your morality on God. Period. You are the created. He is the creator. Under your scenario, it is immoral for any author to fictionally write about torture. We are to God about the same as an author’s creation is to the author. I doubt that you would find much support for that notion.

              2. If it is the thought that counts, you are evil, since you want to kill the notion of God in Muslims. If you successfully convert a Muslim to godlessness, they will be subjected to potential execution. Therefore, you are acting in an immoral fashion because you will get them killed (in reality, not just figuratively). It does not matter that it is a third party that will do the killing, your argument is the instigator of the whole interaction. Since you cannot prove that God does not exist (and thus your argument is not a credible threat), I do not consider you to be evil and therefore you are unworthy of eternal damnation.

              .

              3. Eternity may not be as long as you think. To a child, eternity is when they are sent to their room. To my mind, eternal suffering means until the person is no longer present in the minds of others. Once he is no longer in my thoughts, it is as if he never existed. So long as there are people alive who think of Hitler as evil, he will be tortured and he will continue to be tortured so long as there are people in heaven who think of him. I would like to think that in Heaven, there are only happy thoughts, so therefore, eternity in this sense will be until the end of time (i.e., the end of the world). There is scriptural evidence for this point (that Hell actually does not go on forever).

              4. Sorry, you are wrong about Adam Smith. Read Adam Smith’s Theory of Moral Sentiments and you will find that happiness rewards you. You appear to agree with me. True altruism does not exist.
              5. Prison is a deterrent for those who do not attempt to be caught. Studies prove that the greater the likelihood of being caught, the lower the incidence of lawlessness. Give someone a 100% chance of being caught and they won’t commit a crime. It is the likelihood of punishment that most matters. For a believer who thinks that he will go to hell with a 100% certitude if he commits certain (mortal) sins, it is absolutely a deterrent. You keep forgetting that I am not a Christian. I am not saved by mere belief. I must do good works. Similarly, I believe that you will be saved by your good works. Just stop trying to convert Muslims to atheism. That is evil because it tends to get us killed (yes, by evil people who kill but that doesn’t absolve you of blame in getting Muslims to become atheists).

              Peace Be Upon You.

            24. 1. Even in the “ticking time-bomb” situation, torture is not a reliable means for obtaining accurate information. So when we have very little time to obtain accurate information because of a ticking time-bomb, using means that are not reliable is not the useful nor is it moral. Kant talked about using people as means merely and I think he was on to something there. Besides, this again has nothing to do with the immorality of Hell. Like I said before, there is no moral justification for eternal torture or even torture for 5 minutes.

              1.5 Wait, usually it is religious believers who claim that morality is absolute. So either morality is absolute and we are all subjected to the same morality (including God) or morality is merely relative to God’s whim. Which is it? Euthyphro much.

              1.75 Why is it immoral for an author to write about torture? That torture isn’t real. It is fictional (much like your deity of choice). Are you admitting that your deity doesn’t actually exist?

              2. LMAO!! Let me get this straight. You are claiming that I am evil for trying to convince Muslims that they are incorrect because if I am successful and Islam is incorrect, other Muslims will murder them. That is your argument? Maybe other Muslims shouldn’t murder them for having a different (and correct) opinion. Maybe the Muslim view of murdering those who disagree with them is the immoral and evil intention. My intention is to help religious believers leave a toxic belief system so that we can all live in the 21st century together and build a better world based on reason, logic, and evidence. So yes, my intentions are pure. I am not trying to enslave half the population is sheets nor threaten to murder people who change from my point of view to a different point of view. The very real threat isn’t from me inspiring critical thinking, it is from your Muslim leaders threating to murder you if you leave the faith!

              3. Here you are playing word games to show that eternity doesn’t mean eternity. Come on, you can do better than that. I’m so disappointed.

              4. I’m no expert on Adam Smith, so I might be wrong about his view. My main point is that according to Aristotle the goal of human beings is happiness and morality leads to happiness.

              5. Your chance of getting caught by Allah might be 100%, but if the laws are skewed to begin with, then what does it matter? Your morality has become twisted with religious laws. In this sense morality and “the law” are two different things. For example, the way Muslim societies treat women.

              Again, you are claiming that I am evil because I am trying to educate you to be moral and to rise up against those who will immorally murder you for disagreeing. Instead of fighting against the immoral people (your fellow Muslims) who will murder you for disagreeing, you are blaming me for pointing out their immorality. That’s not on me. As I stated before, the very fact that you have this threat over you which prevents you from being critical of your own beliefs is evidence that your beliefs are weak and in need to critical thought. If critical thought weren’t so damaging to your beliefs, it would be encouraged not discouraged under penalty of death.

              Reason be upon you. 😉

            25. By the way, I wanted to give a variation on Pascal’s Wager that you will come to appreciate from the Muslim perspective and I don’t believe that you can reject it out of hand since the variant in it makes all the difference.

              Essentially, if you are already a Muslim, you should not become an atheist because that will condemn you to hellfire. It is the ultimate sin but not for the reasons that most think. The actual text refers to those who believe and then disbelieve. So it amounts to a Muslim becoming an atheist, which is why you do not want to disbelieve once you become of Muslim. However, there is no guarantee of heaven either, you have to do good but there is evidence that since Allah is merciful, you probably will get in if you do good (just don’t expect it).

              On the other hand, if you are an atheist (or any non-believer who was never a Muslim to begin with), you are not necessarily condemned. Rather the Quran does not say what happens to you and based on what is known as general revelation (since truth is clearly separate from error), if you follow the truth that is in your heart (which we define as rationality, given by God even if you don’t realize it), you may find yourself in Heaven. I really don’t know. What I do know is that you are not specifically condemned to Hellfire. You might be but since I have no such knowledge, it would be presumptuous for me (and quite evil) to claim that you will.

              Going further, since you do not believe, it would even be unwise for me to convert you since there is actually no condemnation in the Bible or the Quran specifically with respect to atheists so long as atheists do not claim KNOWLEDGE of the non-existence of God. God condemns those who are of the book who then disbelieve and those atheists who claim knowledge of His non-existence but not agnostic atheists. Since you might relapse back to atheism, if I converted you, I could be making you subject to eternal damnation (yes, once a Muslim, always a Muslim is our creed — so while eternal damnation does not visit you if you are an atheist, it would visit ME if I became one!).
              Therefore, why would I wish to convert you? I cannot promise you salvation if you convert (we do not believe that you are saved by faith alone) and I cannot promise you damnation if you don’t (since I have no knowledge of what will happen to you).

              Twice in psalms claiming knowledge of God’s non-existence is condemned: See, for example, Palm 14:1 “To the choirmaster. Of David. The fool says in his heart, “There is no God.” They are corrupt, they do abominable deeds, there is none who does good.”

              To say in one’s heart is to claim knowledge and it is different from saying it with one’s mouth or one’s head.

              On the other hand, there is explicit care given for atheists:

              Jude 1:22: “And have mercy on those who doubt;”

              Oh and in answer to your statement about whether Odin exists elsewhere on the site: at least according to the Old Testament he very well might. Nowhere does it say in the Old Testament that there are no other gods. Not a single passage. In fact, it suggests that there are other gods. Otherwise why would God mention other gods and why would he be jealous? Certainly you can’t be jealous of something that doesn’t exist!

              Now there is one passage that comes close to this statement, which is Isiah 44:6: I am the first and I am the last; besides me there is no god.

              However, this is a comparative declaration of superiority, not of uniqueness.

              When we go on to the New Testament, we find a similar statement of superiority rather than uniqueness to the point on the part of Paul in Corinthians 1 8:4-6 but they are inching closer to the statement found in the Quran:

              Therefore, as to the eating of food offered to idols, we know that “an idol has no real existence,” and that “there is no God but one.” For although there may be so-called gods in heaven or on earth—as indeed there are many “gods” and many “lords”— yet for us there is one God, the Father, from whom are all things and for whom we exist, and one Lord, Jesus Christ, through whom are all things and through whom we exist.

              With respect to the Quran, however, we find the Muslim profession of BELIEF (rather than knowledge):

              lā ʾilāha ʾil ʾāllāh, muḥammadun rasūlu-llāh
              “There is no god but God and Muhammad is the messenger of God.”

              In other words, God went from acknowledging the existence of other gods (Judaism) to statements of superior (later Judiasm and Christianity) to outright denial of existence (Islam) but it is important to note that the Quranic statement is one that is a commandment of belief on the part of believers rather than a statement of fact with respect to God, which reconciles this entire strand of argument.

            26. Problem with your variation is that it still isn’t true! First, when you claim that it is forbidden for you to change your mind under penalty of death, you are making an attack on reason. People should always be free to change their minds. I was a believer in God and now I am not. Although it is extremely unlikely, I am certainly open to the possibility (not probability) of changing my mind again and becoming a believer. I will not face threats of death from other atheists if this happens and I should hope that I will still maintain many of them as friends. As an atheist, I go where the evidence is, not where the fear threatens me to be. Is Islam such a poor position that in order for Muslims to continue to believe they must be threatened? Christians have a similar threat of eternal torture looming over them if they question their beliefs. But in their case the threat is imaginary. In your case the threat is real. Other Muslims very well may try to kill you. But that doesn’t mean that they are right to do so. That very fact is supporting evidence that their position (and yours) is weak and you know it. If your position was actually rational, then there would be no need to threaten people who might start to question it. Questioning would be encouraged not threatened with death. Curiosity is awesome and you shouldn’t be punished for raising honest questions about your beliefs.

              On a side note, I have committed the unforgivable sin in the Bible and blasphemed against the Holy Spirit: Mark 3:28-29, Matthew 12:30-32 and Luke 12:10. I did this because I am not afraid of Hell. I don’t believe Hell is real and so I have no fear of it. I don’t believe God or Allah are real either and so I have no problem pissing off these imaginary deities. Obviously blasphemy against the Holy Spirit won’t send me to Muslim Hell, but I have also drawn the Prophet Mohammad a multiple occasions. I even drew him in an unflattering way because I want to make it clear that I am not afraid of Allah and while I am slightly afraid of Muslims, I still think it is the moral thing to do to challenge such immorality. It isn’t evil to stand up to murderers, it is evil to threaten to murder people.

            27. Did I ever say that they were right to do so?

              However, atheism is not resting on any better evidence than theism, sorry to burst your bubble. It is true that atheism rests on a better position than any particular religion but not on whether you have a God or not.

              The First Law of Thermodynamics states that energy is neither created nor destroyed, it is merely transformed. The notion of a creator is actually a misunderstanding on the part of most theists AND atheists. No one knows what happened one second before the Big Bang. It is IMPOSSIBLE for science to determine it. Science therefore CANNOT answer the question as to whether there is a creator. It may be that we have a God who set that in motion. It may be that energy IS the creator but then, I submit to you that would make energy writ large, the creator and, therefore, God. Whether we should worship it or not is unclear and it is equally unclear whether energy writ large is intelligent. If it is, however, then we can state that science has found God. We are wired to look for patterns whether they exist or not. We are also wired to believe in God according to neuropsychology due to our search for patterns and are inherent belief in agency:

              http://www.skepticblog.org/2010/04/20/hardwired-for-belief-in-god/

              So it is not irrational to believe in God. It may be irrational to believe in a particular religion, which is why I tell you that you should not become a Muslim. However, you are ABSOLUTELY and CATEGORICALLY wrong to state that my variation of Pascal’s Wager isn’t true because it does not matter what objective truth is IF that objective truth will get you killed, in reality. No, my version of the wager is 100% correct and it shows why you should not change positions and why I should not change my position but it doesn’t explain why Christians shouldn’t change their position (oh, and if you can get OTHER Muslims to agree not to kill people who turn from faith then AND ONLY THEN can you argue that it is permissible to convert to atheism. That is why you should be supporting my efforts to make Islam more “rational” and give up on trying to convert Muslims into atheists (at least until I change Islam so they don’t go around killing those who leave the faith entirely). Any other position on your part IS evil because you do not understand that there is a time and a place for everything and converting Muslims to ANY OTHER POSITION (whether it be Christianity, Buddhism, or atheism) at this point in time is PURE EVIL since it will tend to get them killed. Since you cannot protect me or other Muslims from being killed, you shouldn’t try to convert them.

              While I do not believe in atheism and am a devout Muslim, you need to understand that not only trying to convince me that atheism is correct is futile, if you succeeded you would be evil since it would get me killed (again you are not evil because you cannot possibly succeed). Furthermore, you would be doing a great disservice to humanity because my work consists of trying to launch a reformation of Islam that will eliminate this type of behavior among Muslims by demonstrating the extremely flawed understanding that they have of their own religion. Islam actually is a very good religion but the kooks who don’t apply rationality to it and instead insist upon blind obedience to their interpretation of the religion (in direct contradiction to the statements in the Quran, which states that you should not blindly follow what others say the Quran states) have perverted it terribly. I would hope that you would support me in that effort (then, after I complete this task if you want to try to convert Muslims to atheism, you can go ahead knowing that you won’t get them killed but it is ONLY THEN that the variant of Pascal’s Wager (from the Muslim perspective only) is rendered invalid. Until then, it is an absolute and indisputable truth.

              Oh, and by the way, you have NEVER drawn the prophet Muhammad. We don’t know what he looked like, so you could never have drawn him. Muslims don’t understand that the prohibition against drawing the prophet ONLY applied to those who were living at the time he was living. The only current prohibition is against making the prophet into a idol but that is EXACTLY what Muslims do when they prohibit Muhammad’s physical representation. Therefore, you don’t have to worry about that. You haven’t sinned in Islam. I know EXACTLY of what I write when it comes to Islam. I hold degrees in Islamic theology and law from Al-Azhar University but again, these opinions are my own and I will be judged by Allah according to them (by the way, any true person of faith, as I am, can only be swayed by temporal punishment — if the creator chooses to torture me for all eternity that is His right to do so. It is not for me to question the wisdom of the creator — that is why Christians trying to save my “soul” are foolish — it is not theirs to save nor is it even mine to save; if God exists, it is only His to save).

            28. 1. You are blaming me for pointing out that followers of your religion are threatening to murder you if you question your religion. That isn’t my fault, that is the fault of the followers of your religion! Place the blame where is belongs.

              2. Atheism is simply the lack of belief in deities. If religious believers cannot provide valid evidence for their claims, then yes atheism rests on a much better position. Until you can provide valid evidence for your deity of choice, atheism will remain the only rational position.

              3. According to Einstein’s Theory of Relativity, space and time are linked. This means that when there was no space, there was no time. In other words, there can’t be a “before” the Big Bang. Stephen Hawking explained it by asking the question, “What is south of the South Pole?” The South Pole is the furthest south one can go on the Earth. There cannot be anything south of the South Pole. The question doesn’t make sense. The same is true with the question of what came before space/time. There can’t be a “before” time. It is a meaningless question.

              4. Yes, we were wired to search for patterns and this wiring has predisposed us to believe in deities. That doesn’t make belief in deities real. In fact, we have been evolving away from such beliefs as we now understand where such beliefs came from and why they are not true. In light of our current knowledge about the universe it is irrational to believe in deities without valid evidence to support such beliefs.

              5. Again, place the blame where it belongs. If Muslims threaten to murder you for deconverting, maybe that belief system isn’t so good. Maybe instead of giving into the bully, you should try standing up to the bully. If enough people stand up against the bully, the bully will back down and we have achieved progress. Becoming the bully out of fear of being bullied is not moral. It is cowardice. Socrates once said to Crito that it is always better to recieve an injustice than to do an injustice.

              5.5 Basically you are telling me that you really don’t believe Islam is true and the Allah is real, but that you are afraid to say so because Muslims will murder you. That is a real fear, but other Muslims have walked away and survived and you can too. You are not alone and you can get help. If you live in a Muslim country it is much harder, but still possible. What country do you live in? I will help to find you a support network.

              5.6 Saying that you will never be convinced no matter where the evidence points is not a rational position to take. A rational person should be open to the evidence no matter where it might lead. If you could provide valid evidence that Allah exists and the the Koran is his word, than I would have no choice but to believe. I take issue with you claiming to be rational when you brag that you are closed to all evidence that might contradict your pre-conceived beliefs. Then, when you claim that Muslims will murder you for questioning your faith, you are only supporting your irrationality. A rational person is not afraid to question his or her beliefs and opinions. A rational person follows the evidence where-ever it may take them.

              6. You criticize other Muslims for blind obedience, but what is it you think you are doing? You just said that it is impossible for anyone to convince you that Islam isn’t true and that you refuse to question your beliefs at all in fear of being murdered by Muslims.

              7. The best reformation would be for those who believe in Islam to stop believing in Islam and accept and apply the scientific method to their religious beliefs. Don’t just ditch one harmful belief, ditch all the harmful and false beliefs! To quote Ghandi, “Be the change you wish to see in the world.” Take a stand and denounce not just one immoral belief that Muslims hold, but all of them!

              8.
              O/

              . I <—- The Prophet Muhammad

              . ^

              It doesn't matter that this isn't a "sin" in your opinion. There are Muslims who would murder me for that stick figure. I don't want to die, but I also don't want to be bullied around by religious assclowns. The purpose of Draw Muhammad Day is to show that we aren't afraid and that those Muslims who would be inclinded to murder people for this would have far too many targets. We aren't going to allow them to bully us. We are taking a stand. Now it is your turn. If you are in a Muslim country, either get out or try to change things. However, as you pointed out before that second one might get you killed. So I would get out first and then try to change things. This is why Ayaan Hirsi Ali is such a hero to many atheists. She left Islam and is still alive to talk about why Islam is a dangerous and false. My friend Alber Saber lived in Egypt and was imprisioned for his atheism. In prison he was beaten by the guards to an inch of his life. He was released from prison and fled the country. He is not only still alive, but also just fathered a baby who he named, Hypatia (after the great atheist scientist). You can leave Islam and live. My friend is living proof.

              9. "It is not for me to question the wisdom of the creator…" Didn't you just criticize other Muslims for their "blind obedience?" Of course it is for you to question any and all authorities especially what that authority (real or imagined) threatens to torture people for all eternity. No one has the right to torture people — not even an imaginary deity. If you are a moral and rational person, you should reject your deity of choice and your religion. You should take a stand against those who threaten to murder you for questioning ridiculous beliefs and stop blaming atheists for what your fellow Muslims threaten to do. I'm not evil for trying to get you to think critically about your beliefs. They are evil for threatening to murder you for thinking critically about your beliefs!!!!

            29. 1. I did place the blame on the follower of the religion but you are not blameless in seeking to place me in their sights. Evil is allowed to occur because good people do nothing or worse turn the spotlight of evil onto others. Someone who tried to get Jews to identify themselves in Nazi Germany because “it is the truth” was EVERY BIT as guilty as the Nazis who came to take the Jews. You are not blameless in this.

              2. Wrong again! Absence of evidence is not evidence of absence and the fact is that an all-powerful God that exists outside the universe can easily cloak His presence if He choose to do so. I have provided a perfectly reasonable rationale for that. I do not have to provide ANY evidence for my deity of choice because I am not making an existence claim. I am making a belief claim, which cannot be overturned through objective evidence. If there is no possibility of valid “evidence” (and there isn’t — regardless of what you claim, I can ALWAYS argue that what you claim to be God isn’t God), then atheism is EXACTLY as rational as theism. That is the problem with you atheists. You are NOT intellectually honest. You may CLAIM that there is evidence that you will accept but that evidence is, by definition, subjective in its nature with respect to God. For example, suppose that we found a way to cause someone who is blind to now see. How do you know that this was caused by supernatural intervention and not science? How about a way to regrow a limb? The same is true? How about if we could stop the Earth from rotating? How would you KNOW that it wasn’t technology? The answer is that you CANNOT. As Arthur C. Clarke stated, “Any sufficiently advanced technology is indistinguishable from magic.” Well, there is one way to prove it and I get to that in the next point.
              4. It doesn’t make God any less real, either.
              5. The problem isn’t with MY belief system. It is with THEIR belief that they ought to impose their belief system on others. So long as everyone adopts the “no force rule”, everything is fine. If atheists try to force their beliefs on others, they would also be evil (and they will try to do so, if they ever got in power since, as you have stated, mere belief in God threatens their existence, according at least to you).
              6.
              3. Actually, you are misrepresenting Einstein’s Theory of Relativity and modern day physics. As I am stating the question of “What happened before the Big Bang?”, I am not discussing time in the traditional sense. While real time certainly started with the Big Bang, all energy was concentrated, according to modern-day physics, in a singularity in which all current postulates of physics simply do not hold. How that singularity arose is unclear. We know that time itself had a beginning in that and we can conceptualize existence prior to the beginning. We also know now that time itself will not end, according to modern-day physics. So the only question as to whether God exists or not is whether there is ever a collapse of the entire system back to a singularity. If there is not, God could be surmised to not exist since God has indicated that the universe will end. If there is, God has just proven Himself by the only mechanism that God would be able to prove Himself categorically: by destroying the entire universe, which he could undoubtedly do because He exists apart from the universe (since even sufficiently advanced technology would be unable to do that since it would exist WITHIN the universe and thus could not see it to completion AND since the laws of physics preclude it).
              6, I am blindly obedient to rationality and that is what God is, as everyone should be, including you. In fact, I KNOW that you think of yourself as blindly obedient to rationality, so there!
              7. Your arrogance is showing.
              8. Cute. Still not Muhammad. What part of you don’t know what Muhammad looks like, therefore you can’t draw him, can’t you understand?
              9. Wrong again. I am not blaming atheists for what Muslims do. I am blaming YOU for trying to convert Muslims just like I blame EVERYONE to tries to convert anyone to their favorite type of ice cream (or to give up ice cream entirely). Death to those who dislike ice cream! LOL. Seriously, you are taking your opinion and presenting it as fact. That isn’t rational.
              Peace Be Upon You.

            30. 1. Holy shit! You did not just say that, did you? You are seriously claiming that anyone who tried to get Jews to actually fight against the Nazis are as bad as the Nazis? Wow! As someone with Jewish family members who escaped the Nazis and who have fought against the Nazis, I have to say that I am blown away by such a comment. No, people who encouraged Jews to fight back against the Nazis were not to blame for the Nazis throwing Jews in ovens. The only people who were to blame for Nazis throwing Jews in ovens were the Nazis and maybe the Catholic Church.

              2. You are not making an existence claim? So then you agree with me that your deity of choice does not in fact exist? If so, then congratulations you are an atheist.

              Absence of evidence should lead to an absence of belief. If you have no reason or evidence to believe something is true, then there is no reason why you should believe that it is true. But as you claim, you aren’t claiming that yoru belief is true. Therefore you are admitting that your belief is not true and so what is the point of arguing in favor of a belief you do not actually hold to be true?

              Russell’s Tea Pot could be cloaked in orbit over the planet, but that doesn’t mean that it is. You can come up with what ever excuse you want to justify why there is no evidence for your deity of choice, but my point is that because there is no evidence for your deity of choice, we should just dismiss the belief in said deity until valid evidence is presented. There could be an invisible pink unicorn in my house and obviously you can’t see it because it is invisible, but that doesn’t mean that it isn’t really there. The absense of evidence isn’t evidence of absence, right? My point is that unless someone can present some valid evidence for believing that there is in fact an invisible pink unicorn in my house, there is no reason to believe there is. I can just dismiss the claim.

              4. Actually it does. We now understand why our brains tricked us into believing that deities were real. Our ability to recognize patterns even when patterns were actually there or when those patterns are more accurately attributed to something else. So yes, our brians tricked us and now that we have evolved even further, we have the ability to realize this and move forward.

              5. Again you are projecting the immorality of religious believers on atheists. Please blame religious believers for things religious believers do. Don’t blame atheists for what religious beleivers do. Like I said before, religious belief is a threat to human happiness, human progress, and human survival on this planet. However, the solution isn’t to murder people, it is to educate people! It is illogical to become the very threat that one is trying to stop in order to stop it. Murdering religious believers will not murder their beliefs. Pointing out the problems with their beliefs and presenting better beliefs in the market place of ideas is the best way to murder beliefs.

              6. “we can conceptualize existence prior to the beginning.” No we can’t! That is the point. In your mind you picture a singularity floating in empty space, but that is not an accurate picture of the universe. There was no empty space for the singularity to float in. We can’t even conceptualize what a singularity would look like because there is no point of view outside the singularity. Time is no different. We can’t conceptualize “before time” would even mean. Just as we can’t conceptualize what “south of the south pole” would mean. That was Hawkin’s point.

              Also, Lawernce Krauss talks about how the universe will end in his book, “The Universe From Nothing.” You can find a 2 hour presentation about the book on YouTube. Just search for it.

              6. Rationality isn’t blind! Like I said, I am open to evidence. You have stated that you are not open to evidence. You have stated that nothing can convince you and that you blindly follow your deity of choice (or at least your interpretation of what that deity wants of you), while at the same time criticize other Muslim for blindly following what they believe their deity wants from them. That’s the real problem with believing in deities, you never really know what they want.

              7. You are the one who claims to know with absolute dogmatic certainty that there is a God and Allah is his name. You are the one who is claiming with absolute certainty that you know what Allah wants and now you are claiming that I am +the arrogant one for not agreeing with you with blind obedience? Please.

              8. It’s a drawing; not a photograph! Second, you completely missed the point even though I spelled it out for you.

              9. You said that you are not blaming atheists and then you go on and blame the atheist. It is a fact that no valid evidence for any deity exists and therefore there is no rational reason to believe in any deity. There is valid reason that deities don’t exist. For starters, there is no evidence that they do. That alone is valid evidence that they don’t. Second, there is the ever popular problem of Theodicy, the ever shrinking gaps, the evolutionary predisposition (which you brought up), etc., etc. While your belief that a god exists is a subjective claim, the claim that God exists is not. That claim is objective as it is a claim about a state of affairs. That claim is wrong! 2+2 does not = 7 and while it is subjective for you to say that you believe that it does, whether it actually does is not subjective. It is not merely a matter of taste whether or not 2+2=7 or whether or not a deity exists. My opinion is that 2+2=4 and I am presenting that opinion as a fact because it is a fact in addition to my opinion.

            31. Four other points:

              1) I have been trying to affect change from within Islam and I have a fairly large (several thousand) contingent. Yes, it is small from the perspective of everyone in Islam but it can make a dent. You cannot affect change from outside the system. That is a lost cause.

              2) It ISN’T the “thought that counts.” It is whether someone ACTS on that thought. I am not troubled by the billions of people who think that I am going to Hell nor should you be because EVERYONE ON THE PLANET has billions of people thinking that they are going to Hell. If I take the approach that you take, I would consider that “It is the thought that counts” and count you as an enemy of all non-atheists since your thought is that we are all going to become non-existent worm food. Since the thought of non-existence is BY FAR more terrifying to my mind than the thought of Hell and I would VASTLY prefer to go to Hell and be tortured forever than to be worm food, well, then I guess I better kill you right now, eh, since “It is the thought that counts” and you, therefore, just threatened me! Don’t you see the ridiculousness and irresponsibility of your line of argument?

              3) Now as to those who ACT on thoughts, YES they DO represent threats. That is why I told you already, you are not a threat even though, BY YOUR OWN DEFINITION, you ARE a threat to me since you believe that I will be worm food. Since your threat is not a credible one, you are not a threat. Besides, as I have already pointed out, there is NO consistent evidence that God condemns all atheists universally to Hellfire and eternal damnation, though he certainly doesn’t approve of them either.

              4) From Stephen Hawking, The Beginning of Time:

              “The conclusion of this lecture is that the universe has not existed forever. Rather, the universe, and time itself, had a beginning in the Big Bang, about 15 billion years ago. The beginning of real time, would have been a singularity, at which the laws of physics would have broken down. Nevertheless, the way the universe began would have been determined by the laws of physics, if the universe satisfied the no boundary condition. This says that in the imaginary time direction, space-time is finite in extent, but doesn’t have any boundary or edge. The predictions of the no boundary proposal seem to agree with observation. The no boundary hypothesis also predicts that the universe will eventually collapse again. However, the contracting phase, will not have the opposite arrow of time, to the expanding phase. So we will keep on getting older, and we won’t return to our youth. Because time is not going to go backwards, I think I better stop now.”

              However, if we collapse back to a singularity, the laws of physics will no longer apply. Since God is the end and the beginning and since the universe had a beginning in which the laws of physics did not apply (see quote from Hawking), then the singularity cannot be subject to any universal law and is thus all-powerful. Since all matter and energy existed within the singularity, is all-present. Since time’s arrow is irreversible and since science suggests that free will is an illusion (but a very nice illusion nontheless), the singularity is all-knowing. Since the singularity is all-powerful, all-present, and all-knowing, the singularity MUST be God. However, since we cannot prove that the universe will eventually collapse, we cannot prove the existence of God but must instead assume it. Since we must assume God (i.e., the existence of the singularity), God cannot be proven since you cannot prove that which you assume. Oh, and since God is DEFINED as the unified creator of the universe, according to Islam, I just proved Allah if you believe in the singularity (as to the rest of what Allah has done, no, I haven’t proven any of that, so maybe we just invented the rest of it but I would NEVER doubt Allah’s existence and thus am a theist through a purely rational explanation).

              End of subjective “proof” of God’s existence

              Please note that if you deny the existence of the singularity, you aren’t being scientific since all cosmologists without exception agree that the univese started with a singularity.

              Now can we stop arguing about whether ice cream exists? It isn’t my fault that we religious types call it ice cream but you insist that it is actually gelato. The problem is that atheists won’t admit that they do believe in God but are merely arguing over whether God interferes in the real world at this time (if the singularity known as God exists, it is demonstrably PROVEN that the singularity HAS interferred AT LEAST ONCE — to create everything in the first instance). Oh, and on that point, you and I can agree: God does not interfere currently in the real world. You happen to believe that the intervention hasn’t occurred since the beginning of time and I think that it hasn’t occurred in a very long time but that is like arguing over which brand of ice cream — and that is pure opinion. Now go eat your gelato and stop arguing with all the theists. It only encourages them to keep insisting, against all reason, that strawberry ice cream is superior to mint chocolate chip when everyone with any common sense knows that mint chocolate chip is the best!

            32. 1. I respectfully disagree with you that it is a “lost cause.” I forget you said it, but the quote was something like, What people perceive as lost causes are the only causes that are truly worth wild.

              4. First, the callapsing universe model is no longer the current model. second, Hawking was talking about time reversing, not before or after time. You are taking his lecture out of context here. Even if the universe were to callapse, time would not reverse. What he was saying is that time doesn’t go forward because space expands. Space/time expands together.

              “singularity cannot be subject to any universal law and is thus all-powerful.” that doesn’t follow. We don’t know how singularities function. That doesn’t mean they are all-powerful. “All-powerful” implies an agency that a singularity just doesn’t have. A singularity doesn’t “know” anything. It isn’t a subject to which knowledge can be applied. A singularity doesn’t know everything any more than a rock can know anything. Rocks don’t have knowledge. I don’t think you actually know what a singularity is. You certainly aren’t up to date on cosmology and I’m no expert on the subject.

              “Please note that if you deny the existence of the singularity, you aren’t being scientific since all cosmologists without exception agree that the univese started with a singularity.”

              I don’t deny that the singularity existed, but I do want to point out that it doesn’t matter how many scientists and cosmologists believe something if the evidence doesn’t back up that belief. In this case it does, so it isn’t an issue however in the most recent episode of COSMOS, NDT talked about a scientist who presented evidence for a claim and every cosmologist dismissed her without considering the evidence. She even started to doubt her conclusions because every cosmologist dismissed her. But she was correct. In science the true authority isn’t “every scientist,” it is the evidence!

              Again, a singularity has no agency. It isn’t a deity it is an object. It has no wants, desires, goals, or asperations. A singularity can’t be angry, sad, mad, happy, or loving. A singularity can’t be moral or immoral. It is an object.

            33. 4. I NEVER said that time would reverse or even implied it! In fact, the quote I gave says the EXACT OPPOSITE! I was not taking Hawking out of context. I merely stated that Hawking believes that the universe will not expand indefinitely anymore (he used to believe that it would). Instead, he states explicitly that eventually it will collapse back. The old theory was of infinite expansion. He is now saying that it won’t happen.

              As to the singularity, it is all. You jsut said that “We don’t know how singularities function”. Therefore, you don’t know that it isn’t all-powerful, all-knowing, all-present, which is what God is. Being all-powerful does not require agency of any sort in any case. A tornado and hurricane are both very powerful (they can destroy a lot) but they are incapable of independent thought. Being all-knowing plus all-powerful simply implies predestination, it does not imply conscious thought, which is something that anyone who believes that free will is an illusion must, by definition, believe (and I believe that you have stated you believe that as well). Once again, you are assuming perhaps too much in the definition. A computer playing tic-tac-toe or even chess can be thought of as “all-knowing” in that if it is completely programmed, it can perfectly account for any move that you might make and can make the perfect alternative but it has no “intelligence” of which we can speak. By definition, the singularity is all-present since all matter was contained with it. So, yes, if you deny the existence of the singularity, you deny God. However, since we cannot PROVE the singuluarity nor can we prove the Big Bang (which emerges from the singularity), we cannot prove God.

              Of course, my argument is one that would suggest that God is a being akin to Spinoza’s God, which you have inaccurately stated is “no god at all.” People who are believers in Spinoza’s God are NOT atheists. They simply believe in a God that has no independent will or other anthropomorphic features:

              http://plato.stanford.edu/entries/spinoza/#GodNat

              “According to Spinoza, God is the infinite, necessarily existing (that is, uncaused), unique substance of the universe. There is only one substance in the universe; it is God; and everything else that is, is in God.”

              However, God is NOT nature in the corporal sense (from a letter from Spinoza to Henry Oldenburg:

              “as to the view of certain people that I identify god with nature (taken as a kind of mass or corporeal matter), they are quite mistaken.”

              It may be said that Spinoza addresses the conception of God as being only philosophical but make no mistake, Spinoza’s God is NECESSARY and if you believe in Spinoza’s God, you are not an atheist (you are very weird sort of theist that most theists wouldn’t recognize as a theist but you are definitely NOT an atheist).

              However, you have stated categorically that you are an atheist. Therefore, I must conclude that you do not believe in Spinoza’s God. Accordingly, since at a minimum, the singularity must take on the characteristics of Spinoza’s God (and He could take on more than those characteristics if Spinoza is wrong), you must not beleive in the singularity. Accordingly, since the singularity is necessary for the Big Bang, you must not believe in the Big Bang. Since the Big Bang is fundamental to our physical understanding of science, you must not believe in science. Too bad you don’t believe in science. So how was the universe created then?

              Seriously though, it is fun to write with you. You are so wrong in that you keep claiming that your opinion (that there is no God) is fact but it is fun because you at least consistent in your insistence that your opinion is fact and the great lengths that you go to try to convince everything that you do not have to prove anything at all (even though you keep insisting that God does not exist, which is a claim, while I make no such claim on God’s existence, instead telling you that God cannot be proven at all). It seems I am the more skeptical of the two of us, after all.

              Peace Be Upon You.

            34. 4. You didn’t read what I said carefully enough. I never said that you said time goes backward. I was pointing out that Hawking was making the argument that it doesn’t go backward and you were claiming that he was talking about something else entirely.

              You are incorrect, the current model most cosmologists believe is more probable is that the universe will continue to expand and all the stars will eventually die out. While this model is far from certain, it is currently our best model. Lawrence Krauss talks about this in his book, “The Universe From Nothing.” Again, you can find a lecture about the book on YouTube.

              “Therefore, you don’t know that it isn’t…” No, that is incorrect. Just because we don’t know how something functions doesn’t mean that we can’t rule out false ways that it functions. I don’t know how my computer works, but I know there aren’t gerbals inside powering it.

              Again, singularities have no agency! They are objects without personification. Unless you are prepared to say that God is a mindless object no different than a hurricane, your argument has failed. Also, you claimed that God’s name was Jealous. Tornados can’t be jealous.

              Again, I am not denying the existence of singularies, we know they exist. I am denying that a singularity is the same as a deity.

              I don’t believe in Spinoza’s God. I don’t believe in any gods (except for Oden because he defeated all the Frost Giants). I do accept the evidence in favor of the existence of singularities. I just don’t attribute supernatural characteristics to that object. Your attempt to play verbal gymnastics has failed. Sorry. :-(

            35. Hi Staks, why is it as important as it is to you to argue belief with strangers? There will always be atheists and there will always be believers. When it turns verbally abusive or defensive as it appears is often where is your gain? I couldn’t thrive in an environment like this, nor would I want to. Can you tell how this works in a positive manner for you?

            36. Chuck, I’ve been reading your comments and I agree with you. The best verse, (I don’t have it 100% memorized by book, chapter and verse and right now should be getting some sleep before work) to explain DT’s misunderstanding is simply something like the one when Christ was explaining that if you deny Him in front of your peers, He will deny you in front of His father.
              DT, remember that the stoning of people for their sin was already happening before the birth of Christ. Jesus came to us to explain that nobody is perfect, not you, not me, not Abe Lincoln. No human being is more deserving of heaven than any other. Christ is there, He is here, in my heart or in whomever’s heart that believes and asks for His promise. If you don’t ask for it you will not receive it. Why should you? How can you ask for something that you do not think is real? It is impossible. That is simple logic and should at least make a bit of sense whether you believe or not.

            37. God’s Son lives–You need to proof read your comments before you post. Is “crafts” supposed to be “Christ’s”? One sentence is completely beyond understanding. If you’re going to speak for us Christians, be accurate because non-Christians will hold you to a higher bar than to themselves or their peers.

            38. I hold everyone to the same standard here and I don’t take points off for spelling and grammar as long as I can understand the ideas being expressed. Here evidence and valid arguments count more than spelling.

            39. What? I can’t understand what you’re saying. It sounds like you’re clumsily re-presenting Pascal’s Wager, which has been shown to be absurd too many times for me to bother doing so again here. Further, it appears that you’re trying to tell me that the Bible tells you to treat your fellow man with respect and be a good person. Are we reading the same book?

            40. “I die leaving a good memory behind and then buried never to be alive again.” and there we go again. Somehow christians are intrinsically better than atheists.

          4. I have a computer science degree and also had a NDE in 1998, where I was clinically dead for just under 5 minutes. I can’t say it made me a believer in Christ, but I can tell you this life isn’t the end. You have faith there is no hell. I am not so sure, and unlike the person you were chastising I do have evidence, albeit anecdotal.

            I laughed when a doctor told me the after death experience I had was induced by the release of DMT(which he called the most powerful hallucinogen on earth) at death and created an hallucination of an after life. When he asked me why I was laughing I told him it was because I was a recreational drug user in the 60s, had done DMT several times and it was nowhere near as powerful as Belladonna. He raised his eyebrows as I extrapolated.

            I explained to him that when you come down off of hallucinogens, you know the difference between hallucinations and reality, much like when you wake up from a dream. Then I assured him what happened to me was real and not an hallucination, and if anyone knew the difference it would be me. Of course he had nothing.

            Medical science’s position on NDEs is nothing but an incorrect theory meant to debunk any connection to spirituality or the supernatural. Unfortunately in my world this is not science.

            Science relies on faith all the time. The big bang theory relies on a number of hypotheticals. Things like inflation, dark matter and dark energy are the most prominent examples. Without them, there would be a fatal contradiction between the observations made by astronomers and the predictions of the big bang theory. Yet these things have never been observed, they are assumed without proof. This is not science either, and would not be tolerated in any other branch of science.

            However there is no greater parallel between religious faith and science than the postulation of a multiverse. In Stephen Hawking’s new book the authors postulate that two pre-existing universes collided and the result was the birth of our universe(big bang). There is no more proof of this than there is of a supreme being creating our universe. None.

            Religious people spend their time and money on Bibles, whereas atheists spend their time and money on intentionally inflammatory books written by Hitchens, Dawkins etc. I see no difference.

            IMO the one real truth is no one knows the real truth, and no one should assert that they do.

            PS You probably should have listened to the whole spiel before you hastened to denounce it and used speculation to buttress your critique. They actually do tell you what the cures are if you listen to it all. Extract of frankincense was one, olive oil was another, and I can’t remember the rest.
            Cheers,
            Eldritch

            1. Science = The best explanation for what we can observe using the least/most-likely-to-be-true assumptions
              Religion = Stuff science, I believe what I want
              Difference = One is more likely to be true (you’ll never guess which one)

          5. So yr the genius who believes that Life can create itself; that in Nowhere and Nowhen, Nothing exploded for No reason and created Everything; that a reptile can lay an egg w/ a mammal inside; and that scaly, cold blooded reptiles w/ reptilian lungs and hips, magically transformed into feathered, warm blooded birds w/ completely different avian lungs and hips? Your intelligence is imaginary as is yr faith of evolution. Shame on you for spreading lies and deceit out of yr own ignorance and vanity. I don’t believe the claims from the man pushing the book but that by no means invalidates the Bible or Christianity. It validates what the Bible says, “Beware of deceivers who come in my name…”.

          6. Hi Staks, how do you know ones diety of choice is not real? Regarding the Mathew 4 protocol, could you please elaborate on the 3 universities and their evidence backing up the protocol? Thank you

            1. Since there is no evidence for any deities, one’s deity of choice is almost certainly not real.
              3 universities? Please present their evidence and how the Bible specifically claims that this treatment will cure disease? Thank you 😉

          7. How do YOU KNOW, it’s not? Atheism is just another religion, basing it’s rules, that were created by men, that choose not to, believe or follow something they can not see or touch with their own physical body. No matter how you word it MAN CAN NOT & HAS NOT CREATED ANYTHING, that was not ALREADY HERE (on earth). With that being said, please ENLIGHTEN me, SAVE me from my own ignorance (LOL). Whew forgive me, but I do find it funny that Atheist’s try and treat people that do believe as if they are dumb. Bottom line you either believe in the spirit of GOD (and ALL that goes with it) wich is limitless, thanks to the imagination (not created by man) or you believe in man (and ALL that comes with it) which is limited to only what man can create, which was already here when MAN got here. Which means MAN didn’t CREATE, he USED what was ALREADY here! I said that to say…
            Believe in LIMITS or BELIEVE YOU’RE LIMITLESS! Your choice. Me I’M LIMITLESS.

            1. First, I never claimed nor treated anyone as dumb… until now.
              I don’t really think I should be the one to tell you about the birds and the bees, but I know that man (and woman) create other human beings because I have seen a baby come out of my wife. I reason that since I was once a baby, I probably came out of my mother. I then reason further that all human beings were once babies and therefore they all probably came out of their mothers.

              Now we are even. You treated me as a dumb person and I responded in kind. Happy?

            2. I see now why your name is dangerous. You like to insult people that you have know idea as to who the hell they are. But that too, is cool with me. Simply because I believe in GOD doesn’t mean that I won’t ask him for forgiveness later, for a sin I might commit in a fit of anger. Just know that insulting people can be dangerous to ones health. So please DON’T believe it, I DARE YOU!!! Now you can kick me off your page to never let the public hear from me again. Not a problem it’s your page & your forum, I’m just a guest with an opinion. I will admit that I’m NEW to the forum thing I was trying to find out about this cure for cancer stuff & came across this forum, when I clicked on a link in a google search. I foud it interesting. After going back to the very begining I saw that the quote I said was yours belonged to someone that is listed as ME. I ASS – UMED, it was YOU. My bad doesn’t make me dumb, just means I made a mistake. In regards to WHO you insulted, not IF you insulted anyone.
              Anyway let me know when your more thatn just talk, let me know when YOU can put action behind that mouth YOU THINK, you have. YOU didn’t create the ameba so how the hell can YOU think YOU created anything. IT the ameba was here BEFORE YOU got here. How did the ameba get here. It damn sure wasn’t by your mama or dad. YOU SIRRED your children & your wife (poor lady) bore your children but neither one of you created a damn thing. But I understand you need to twist shit to make it fit your level of thinking because it would fuck up your whole mind to think otherwise & then realize that you been wasting the worlds time. Simply because the world aint shit beyond what your limited mind can fatham. GOD didn’t answer your prayers so now he doesn’t ezxist because GOD didn’t live up to YOUR expectations. Well based on your writings & your attitude I’d turned a cold ear to your prayers too. But hey I’m human so I can LOL. Anyway holla. Now GOD may get mad at me for being combative, so he’s gonna have to forgive me, ’cause I have mastered that turn the other cheek shit yet, but I’m workin on it.

            3. Why would I delete your comment? It is hilarious!!! First you insult me and then when I insult you back (in a joking fashion) you insult me further, insult my wife, AND threaten me… all while yelling with your caps lock too. I love that shit.

              BTW, it is pretty stupid to take a Christian’s comment that insults me as my comment that insults me. That’s a pretty stupid mistake.

              My point is that you started the hostility and then you continued the hostility with threats. The most I did was treating you not even in kind (since I never threatened you). Go cry me a river.

              *Christians and their persecution complex*

            4. No I didn’t insult you in the begining. NBUt I understand YOU have this insaciable need to be right because GOD didn’t answer your prayers, aww boo hoo. Get over it. simply because GOD doesn’t live up to YOUR expectations doesn’t mean he doesn’t exist. It just means that your dumb ass aint found him yet. And if there are others like YOU, then their dumb asses aint found him uet either. And they shouold stop following yo dumb ass ’cause YOU lost.
              are we done now or do you need the last word. If so just let me know how to get my name of the reponse list, ’cause I swear I aint got time fro a dumb ass m otha fu c a like you. So please, please delete me damn I’m sorry I wasted my time.

            5. LOL. Delete you from what? I never added you to anything. You came to my blog and started treating me like I was stupid (while falsely accusing me of calling people stupid), yelling at me with caps lock, insulting me, and threatening me. Believe me, I would never put you on any of my lists so I have no idea what you want me to delete you from? I’m going to leave your comments up on the blog post because 1. they are hilarious. 2. they are evidence in case you try to actually follow through on your threats. 3. because they are a great example of what I have to deal with from “peace loving” Christians on a daily basis. and 4. because they truly are hilarious.

              A little piece of advice. Stop yelling, be a nicer person, and enjoy your one and only life.

            6. Insult you back (in a kind way)? What does that even mean? I hate to say this….I didn’t want to bring myself down to your level. But you really are an absolute idiot!!!

          8. Evidence? That god is real ? Look around you. What more evidence do you need. Do you think everything just magically appeared & we just evolved from a fish ?But where would the fish come from ? Would it just magically be there & magically evolve into a human being with over 200 bones in it’s body? & just so happens that the bones are placed perfectly in your body so you can walk, talk, breath, ect. & animals too, there’s hundreds of different species of animals, but they probably fell out of space huh? But how did space even come to be there in the first place ? how was the earth there? how was anything there? Oh, maybe magic right? Or we can listen to “scientists” & believe that it was just always there. But no. That’d be stupid. Like everyone who believes that bullcrap.
            You must have been poorly raised. Try reading a bible. It actually would make sense on how everything came to be instead of believing it was just always there or “magic”.

            1. Agreed. It actually takes more faith to NOT believe in God than to believe.
              Not to mention that we all have interchangeable parts for transplants, if I need blood I can get it from someone else I don’t even know. My mom-in-law was diagnosed with AML in 1999. At 62 she received a bone marrow transplant from someone unknown and unrelated. Today she is 77 and lives a vibrant, happy, Christ centered life.
              To believe that was all by happenstance takes more faith than believing that God created it all including the science behind finding the ability to even use bone marrow to save someone’s life.

            2. Wow, the old, “if takes more faith not to believe bullshit than it does to believe bullshit” routine. I haven’t heard that one before. – http://www.examiner.com/atheism-in-philadelphia/atheism-101-does-it-take-more-faith-to-be-an-atheist

              No, the Bible doesn’t talk about bone marrow transplants. Human beings learned about it through studying to human body with scientific reasoning. It was hard work with long hours and lots of fighting against religious people. Thank a doctor and a scientist for your medical miracles, not your favorite imaginary deity.

            3. I know it’s kind of lame to use a worn out statement. But, we all do it.

              and you’re correct, no bone marrow transplants in the bible. But it is pretty amazing that we can use body parts from others, dead or alive, to help someone else live. Not to mention animal parts.

            4. Yes, it is amazing. Science is awesome!!! Don’t try giving the credit to your bronze-aged deity for the awesome work of modern day scientists and doctors who through the scientific method have been able to do amazing things. Faith cannot compete. Next time your mother-in-law needs a transplant, ask her if she would rather see a priest or a doctor. I bet you the doctor will win every time. Science will win because it works.

            5. Actually, she gives praise to God for the doctors who took care of her and for giving them the knowledge to allow her to be healed.

            6. That’s not very nice. Those doctors worked hard to help her and she won’t even thank them for their hard work and skill? Instead she thanks some imaginary being right in front of their face? That’s like a big FU to the doctors, don’t you think? Unfortunately, most doctors in the country are probably used to it and just shrug it off. But maybe next time you can remind her to actually thank the people who actually saved her life instead of thanking the imaginary deity she believes gave her the medical problem to begin with. Just say’n.

            7. We have explanations that actually fit with the evidence. Of course you can believe that god created a flat square earth that the sun revolves around in 6 days around 6000 years ago.

          9. I used to be an agnostic. Then I watched Father Robert Barron’s responses to atheists on you tube. I would like to know your impression of these. I will just watch here for your response to watching them. Thank you. GWG

          10. Because Jesus lives in my heart is how I know he is real. The Devil, Hell, and Heaven are also real. The Holy Bible is also the living word of God! I guess you will have to find out when you die if they are real if you don’t except Jesus Christ as your savior now but then it will be to late for you. Today is the day of salvation That is your BIG loss, but I will pray for you.

            1. Tom Cruise knows in his heart that Lord Xenu is real. How can you dismiss his personal experiences with Lord Xenu? Maybe you will find out that Tom Cruise was right when you die. But by then it will be too late. That would be a BIG loss.

              If only we had a method to help us figure out which one of you is correct (if either of you are correct at all) that could independently verify and evaluate the facts… oh yeah, there is that Scientific Method thing. Maybe we can try that out. What do you think?

              Besides, would you really want to worship a deity that allows for billions of people to be tortured for all eternity? Think about it.

          11. Without God there is no inherrent good and evil. Therefore, there is no righteousness or shame. You can not call judgement bad (shameful) without recognizing a moral law that supercedes human feeling.

          12. D.T.
            We judge you by your words, which reveal and reflect the life you live, and the principles you live by. It is possible to learn a lot about a person by what they say, what they condemn, what they believe in and don’t. How they respond when confronted on those beliefs. Your response, is consistent with your words. Sad, Angry, Empty, Defensive. The shame is on you. What people say to you are not Threats, but Truths. Your response is akin to a man going skydiving but refuses to wear a parachute. Someone hears you talking and it is evident you neglected to bring a chute. We tell you that if you jump out of the plane you will die. And your response “Don’t threaten Me!” As you jump out the plane we can only pity you.
            We all live by Faith my friend. And that Faith is based on Evidences we choose to accept or reject.
            We have no proof the car next to us will stay in their lane. We have no proof that the food we eat is safe.
            The majority of human knowledge is not based on personal discovery, but on faith in other’s discoveries.
            You read a book about history but you were never there. You may not know how to read Ancient Greek Scripts.
            Books mention Fossils, but have you touched them yourself? Did you dig them out of the ground?

            How much of your Knowledge and Beliefs are based on the Testimony of others as Evidence.

            I dare say 99%

            But you Confuse PROOF with Evidence my friend.
            The World is FILLED with Evidence of and for God. You choose to dismiss that evidence. And that is the free-will God gave you.
            Salvation and Grace is the Gift he has held out to you, but that too requires you to have Faith and Believe in Him.
            God Bless you on your Journey to him. May your Spirit find, what your Pride rejects.

            1. Here we go again. When someone tells me that I will be and should be tortured for all eternity, that is a threat. The intention there is to be threatening. Granted, most Christians don’t actually intend on carrying out that threat… although I have met quite a few who do. No, your threats are imaginary just like your deity.

              I never asked for proof of God. I asked for valid evidence. You claim the Bible provides that evidence, but it really doesn’t. In fact, the Bible is pretty strong evidence against the claim that the main character (God) exists. The Bible is been shown to be flat out wrong about history, biology, cosmology, and morality. It was also extremely poorly written and is self-contradictory in more than a few places.

              What people value does say a lot about them. I value science, compassion, tolerance, education, curiosity, equality, and critical thinking. What do you value? Authoritarian rule by an imaginary lord, treating women as property, dogmatic thinking, indoctrination, conformity, fear, personal attacks, and eternal torture.

              Evidence is something that can be tested, peer-reviewed, and observed. As a point of fact, prayer has been tested and it has failed every time. Instead of pointing out actual evidence for your deity of choice, you just assert that he is real and claim dismiss the science that strongly supports evolution via natural selection and the big bang. All you have left is the God of the Gaps and thanks to science those gaps are getting smaller every day.

            2. Yes we have no proof against god or for science beyond all possible doubt, but we do have the proof beyond all reasonable doubt. It’s fine by me if you don’t want to be reasonable.

          13. If you didn’t need faith, there wouldn’t be religion. That’s why we don’t go there and why you cannot understand religion.

            1. Again, we already agreed on why people have faith. It is a byproduct of our evolutionary skill to find patterns. Sometimes we find patterns that aren’t even there.

          14. John 20:24-29

            King James Version (KJV)

            24 But Thomas, one of the twelve, called Didymus, was not with them when Jesus came.

            25 The other disciples therefore said unto him, We have seen the Lord.
            But he said unto them, Except I shall see in his hands the print of the
            nails, and put my finger into the print of the nails, and thrust my
            hand into his side, I will not believe.

            26 And
            after eight days again his disciples were within, and Thomas with them:
            then came Jesus, the doors being shut, and stood in the midst, and
            said, Peace be unto you.

            27 Then
            saith he to Thomas, Reach hither thy finger, and behold my hands; and
            reach hither thy hand, and thrust it into my side: and be not faithless,
            but believing.

            28 And Thomas answered and said unto him, My Lord and my God.

            29 Jesus
            saith unto him, Thomas, because thou hast seen me, thou hast believed:
            blessed are they that have not seen, and yet have believed.

            1. While this has nothing to do with the comment I made about which of the Ten Commandments outlaws rape, slavery, and genocide, it is a valuable groups of verses. Here Jesus give Thomas the evidence he needs. So my question then follows from this verse. Why does Thomas get evidence, but we can’t have any today?

          15. But you state your life, You are an unbeliever of any faith.

            You should look up the meaning of faith

            I never “saw” my husband’s love but I knew it was there. I felt it.

            My children have love and respect for me but I can’t see it.

            I was comforted when my husband and oldest son died. Couldn’t see it but I felt it.

            To have faith, is to know true love, respect and comfort.

            1. Well shit, I can’t hear the color blue so I guess it must not exist, right? We have senses and not all our data comes to us from one sense. Love is an emotion. We sense it through a series of actions and attitudes. We have reason to believe our loved ones actually love us and we have reason to believe we love them back. Give me a valid reason to believe in deities. There isn’t one. You can’t sense a deity through any of our senses or through any scientific instruments. We can test someone’s love, but when we test for god, we get zippo. Now stop being an insulting assclown and do some research on this stuff. Go Google evidence for love. Hell, I have written about that topic on this very website at least once already. Think about it.

          16. And you have evidence for whatever it is you believe in?

            It takes a hell of a lot more faith to believe we just came to be then to believe in a creator.

          17. The evidence is all around bud, God created the heavens and the earth. Anyone who thinks otherwise has every right to do so as we are given the choice and free will. However it seems that anyone who doubts God and His creation do so only for the sake of discrediting Him.

          18. It is quite noticeable that Atheism has become a Religion these days. Atheists are in a hurry to ridicule Bible believers or God believers. Atheists are doing today what people, in the name of religion, did and still do (etc. Islamists), prosecuting ‘non believers’. This is the process which takes place when people feel the need to impose their beliefs on others: Phase 1. trying to convince people that your way is the RIGHT way, if you fail then comes phase 2. ridicule and use of verbal abuse (like the above article), if this fail you resort to phase 3. intimidations and shaming. If this fail you will end up in phase 4. Violence!!!! . Do we really want this????? I say stop now and respect each other’s way of life, religion’s beliefs and health beliefs.